Description :
From Genome Similarity Track
Location :
contig_122:67297- 69205
Transcript NameFunction/comments
g13479.t1XP_008894426.1 hypothetical protein PPTG_03504 [Phytophthora parasitica INRA-310

Sequence
1908 bases(100 bases per row)
TATCTACTACAGGTGAACAATTGGCTCAATCGAATGTAAAGTTAGTCTGGAAAGGAAGCCTCGGCGTGGTGCGACCTGAACCAAAAGTAATTCATCCCGG
GGGAGGCCATAGCCGCTGTTTCCTCTAGGGAGTCCCCTCCTACCGATACCCGCATACTTACTGACTGCAACTAAGACTGCGGCCGTGTATGCCTCGAGAG
TTCCGACGATGCAGTCTGGCGCTCGTTGGGGTAACGTATAGAGCGACACGCAGGGACGCTTTACCGGTGGTGGGGATTCTGGCAAGTATTTCGGCGGTGA
GTCTGTTATTCTAGTGGGTCCACTCGTTTGCTGCACACCAAACAGCGAGCAACGAACTGGGCCCGCGCCATATGAAGAATGTAACTGGTAGTTGCGCATG
CTCTGTTGGTAGGCACCAAGTTAAACAGCAGCGATTGGCCTCGACTGCAGGAGACGAGTTTCACGTTAGCTCGCCGGTAAATGCGCACTCGATTCCAAAC
ACCAGCCACCACAGCACGGTCTGTGCTACAGACGAGTCTCTACGTCCACACTGATCCACCACTGCCAGTCAGCCCAAATCGAACTTTTCAGCCAGCCAGC
AAGTATGTATACGGCCGAACGAGTCAAAACTTTCGGTGTGCGCGGCAACGAACTCGCCAACTTGCTTGCTTGGATGATCTACGCGAAGCAAAAACACGCG
ACGGCGAGTACGTACCCCCTGCCGGTCGGCCCATACAACGACCAAGTCAACCAGATAGAAACGGCCACAGCCGGGCCGCTCGACCGAAATTAACGAGCAA
GCGTAACCTTGAATAACCTGCGCTGTCACACCCGCCGATCAAGTCCAAGCCGACCGATTGAATGCGCGCATACCACCCTCGTCACAGACGCCGCGCTTGA
TACTCAAGATGCAGCTCCAAGCACCGCCACGGCCAGCAATGCCCTCGCACACTTGGCCATTCTGCATTTCACCAGCTACTGGTCAAGCAAAGCAACCTAC
CAACCAACGCAAGTCGACATGGCTCCACTGCCATCTGCAGCGCAAGCAACAGCCACGCCCGACGTGGCACCCAACGCCAGTGCCGCGCAGTGCTTCGACG
ACCTGGTCGACAAGGTCGAAAGTGGCTACGCGGCCATGCCCACAACCCCCAAGACTGCCACCGCCGCACCGGCCTTCGCCCCCGTCAAGCCGCAGGGTCT
GGCACGCTTCGCCGTGCAGAGCGTGCACATGCGCGAGTGCTTCGCCGAGTTCCTCGGCACCTTCGTCATGATCGTCTTCGGCATGGGCGTGAACAACCAA
GTGACCAACTCGCAGGATGCCAACGGCACGTGGCTCAGCATCAACATGTGCTGGGGAATTGGCGTGCTCATCGGCGTGTACTGCTCCGAGGGCGTCAGCG
GCGCCAACCTCAACACGGCCGTGACCCTGGCCCACTGCGTGTACGGCCGCCTGCCGTGGTGGAAGGCGCCGGGCTACATGGTGTCGCAGCTGCTGGGGGC
CTTCTGCGGTGCCTTCGTCATCTACGTCATGCAGTACCAGAACCTGAACGTGATCGACCCGAACCGCGAGACGACGCAGAGCAGCTTCGCCACGTACCCT
AGCGACCAGATCTCCAACTACACGGCCTTCTACACGGAGTTCATCGGCACGGCCATGCTGGTGCTGAGCATCTACGCCATCACGGACAAGCGCAACAGGT
CTGCGGGTCCCGTGGGCTCTCCGTTTGCGTTTGCTCTCATGATCATGGCGCTGGGCATGGCGTTCGGCATGAACACGGGATACGCTGTGAACCCTGCGCG
CGACCTGGGTCCTCGCCTCTTCACGGCGGTGGCCGGCTGGGGCTCCAAGGTCTTCACGACGCGCAACTACTACTTCTGGATCCCGCTTGTGGCCGACTCG
CTGGGCGG