Description :
From Genome Similarity Track
Location :
scaffold_333:6729- 32097
Transcript NameFunction/comments
g7370.t1hypothetical protein
g7371.t1 conserved hypothetical protein
g7372.t1 Mitochondrial/chloroplast ribosomal protein L13
g7373.t1hypothetical protein
g7374.t1 conserved hypothetical protein
g7375.t1 Mitochondrial Carrier (MC) Family
g7376.t1 hypothetical protein PHYSODRAFT_551984
g7377.t1 cysteine protease family C01A, putative

Sequence
25368 bases(100 bases per row)
CACTAGCCACCTTTTGACCCGAATAATGTTGAATTCTTGGCAGGATACACGTGGTCCAAGATAATCAGCTCGCAGAGTGACGACGATGTGCCAGCTCCAC
GCTGGAGACATTCCGCTGTTCTGTTTGAGAAGAATATTATCATCTTCGGCGGCTTTGCGGCTGAAAAGAGGATGAACGATCTCTGGCTCTTCAACACTGA
GTTGAAGGTCTGGGAGCAGAAGTATGCACAGGGCTTCTGGGAGGGGCTACCGCAGTGCCGCGGTGCACACAGTGCCACACTTGTCGGTGAGAAAATGTAC
GTGTTTGGAGGCTACGGCGGCAATGGCTTTGGTCGTACGGACTTCAATGATCTCCACGCGTTGGACTTGCACTCGTTCAAGTGGCACGAAATTCAAACTG
AAGGGGAAAAGCCGGAGCCACGTTCGGGGCACCAAACGTGTTTGGTGAAAGAGCAATTGCTGGTTATTGGTGGGTGGAACAGCTTTAAGCAGTTTCAAGA
CATCTTCGTGTTTGATTTGCCTACCGCAACCTGGAGTTTGCTGAGCACACCATTGAATTCTCCTATTTGGAACCACACATGTGTGAGCGTGGCAGCTGTA
CCTCACTGGAAGGTCTTCCTATTTGGTGGTAACAGTGGAGATTTGGCCGAGTCCGGAACTGCGCAGGGGGCATATCTGAATAGCACTACTGTGTTGGACA
CTGGTAGTATGGTGTGGCTAAATCCACCGGTGAAAGGAGAACTCCCCAAGGCACGAGCTGATACGGCCATGGTGTTTGATGGGAACACCAACCACTTGAT
TTTCTTTGGAGGGTGGGCAAATCGCTGGTACAACGATTTGCACGTCCTTAATGCAAGCGAGATTGTCGGACCTCCGTACTCCATCTCATCGATCGAGCCG
AAGCAAGGACCGATCACAGGTAACGCGAGGGTTAAAGTCACTGGTTTCAACTTCACCGGCCAGAACGCAACTCTGCGATTCGCAGTTGCTAAAGGTTCAG
TGGATGTCACTGGAGCTGTTCTCAGTCCTACCGTTCTCCAGGCTACAGCTCCCAGCTTTGAGAAGTTTGGAGCGTTAACTTCAGAAGTTCGAGTTTCGCT
AAGTGGAGGTATGTACACCAACGTAGCCACATCCTTCCGGTTCCACTCAGTCACCACAGCGCCCAAGTCGCTGGCGTTTGGCCCGTGTTTAATTGCTGCT
CTCAGCGATAACTGTTTGGCAGAGTTACCCACGACGTTTATCATCCAGTCTCGGGATAAAGACGATAATCCTCGGGATTGCGGGGGCGATGAGTTCATTA
TTACTCTGAAGTACTGTGATGACCCCCAAGCAGAAGAGGAGCAGGTTGCGTCTATCGTCGACAAGAACGATGGCACCTACGTGGTGACGTTTACGCCATC
CAGAGCAGGGAAATACGATATCTCGGTGGACTTCACAGGCACCTTTAATGGTATCGCTGGCCCTATTCGTGGTTCTCCGTTCGCTGCAGAGTTTCAACCT
CCTTCGGATGAGAACAAAACAAAATGCCTACCGCCTCTTGCTACGCAGAAGGACTTCGATTCACCTGAGCTGATTAGGCGTGTGATGGCCACAATGAACA
AGCGCAATGGAGAATTCCGCCGCATTCTTGTGGATCTGAGGAAGGATATCCCCAGCAATGACACAGACGGACTGGAAACTCTACGAAAGATGAAAGAAAT
TATTCGCAAGCTTGAGACGGACAAGGACACGAACCATTTAATCCTGGACCAAGTACGACAACTGTTCTTCAACATCAAACAGAGTGGCGGCCATGTCGAT
AAGGAGCTGGTAGAGATCGAGAACATGGAGAAGCTCTTCATCGATGTCGAGAAGCAAATCCCAGTGACAGAGAAGCGCACCCAAGAGCCTACTCGGATCT
TCAGTGAGAAGACGGAGGAGAAGATCGTCGCGTATGAAAAGCTGATTGCGCAGAAGATGGAGACGCTCAAAACGCTGGATTTCTGGTCTTCTAAACTGGA
GCCTGACAAGGGTCTGGAGAAGATCGAAAGCTATCTCGTCGACTGGAACATGGAGATGAAGAAATGTGAGGAAAACACGAAGTTGTGCTCCATTTTCGGG
TTCCCACAGCTTATGAATGAGTCGCTTCGTATGATGGGGCTCATACGCGCTGATGCTGATGCGATGAAGACAGTTTGGGCAATTATTAAACGTGCAAAAG
CATTTTTCAAGGCCACTCAAGACATTTTGTTTAAGGAAGTGGACGTTAACGCGCTGCAGATTGAAGTGCAGTCGGCATTAAAGGAGCTAAAGAGAATCCC
TAAAGGAATCCAGTGGAGTGATGCATACACTTCCATTTTGAAGGAGTGTCAGGCGTTTGACAAGACCCACCCTCTCATCCGCTGCGTGTCGTCCAGCTAT
ATGCGCCCAAGGCACTGGAAGCGTATCATGGCGCACACAGGAGAATTCCCTACGCCAGACGAAGACCCGGACCAAAAGCTATCGCTGATTTTGAGCAAGA
ATCTTTTCAACTTCAGTTCGGACGTCAATGAGATTTGCTACGAAGCAGAGAAGGAGCAAGAGCTCGAGCTTCGACTGATCGAACTGGAGGCGCTGTGGGC
GGAAGTGAACTGGGAAATGTCGCCGTACAACCCTGGCGCTGCAGAAGAAGACGTCGTTCCTCTTCTCAAAGTCTCCGAAGAGAACTTCGAGCTGCTTGAA
ACCCACCAAATTGATGTCCAAGGTATGAGTGCTTCCCCATATCAATCGGAATTCGAGCCACGCGTTGCCAAACTTCAGATCGGCCTTTCGTCGATCAATG
AAGTCGTGCTTTTGCTGGGCGACATCCAACGCTCGTGGAGTTACTTGGAGCCGCTCTTTATTCAGTCCGAAGAGGTAAAGAAGCAGTTGCCGGAGCTGAC
GTCCGACTTCGAAGACATCGATAGAGAAGTCCGTCAGATCTTGAAGACCGCGTGGAAAACCCTTAACGTCCAGGAAGCATGTACCGAGCCTGGACTCATC
AAGCGACTGGAGGTGATTGTAGAGAAGCTGGAGCTGTGCAAGCACCGCCTCAAGGAGTTTCTCGACGGGCGTCGTCGCCAATTCCCTCGTTTCTACTTCA
TGTCCGAAGCAGACTTGCTTGATATCCTGTCGAACGGGTCTCACCCCGACCGCATCATGCCGCACTGCTCCAAAATCTATCTGGCTACCAAGACTCTCAC
TTTGGTGGATCGAGGACCGGGGGAACGGCAGGTTGCTACGTCTTTTGTGGCTGGTGTGGGGCACGAGATTGTGGATTTCTTCGAGCCCCCGATATTGGAA
GGAGAGGCAGAGATTTACCTGGAGACGATCATGCGTGCAATGAGGTTGACGCTTTTCAAGCATATCGAACGTTCACTGGTAGCGTACACTGAAATGCCTC
GTGTGGACTGGATCAACTTCAAAGATGACACGAACAAGCCCATGGATGCAGCGCAGATCATCCTGCTTGCGGCTGGAGTGCACTATGTTCAAGAAGTGGA
GCGTGCGTTCCGTGCTATCCAAAGCGGCGAGAAGGATGCCCTGAAGAACTACAACAAGATGCAAGAGAAACAGCTGGAAGACCTGATCAAACTCACACAA
AGTAACATTTCGTACGCTGAACGACAGCGTGTGATGGTCCTGATTACGATGGATGCCCACGGTCGAGATATCGTGGCCAACATGATCCGAGCCGGAGTGG
AGGAGGCCACTCACTTCCAGTGGCAGTCCCAGCTCAAACACTACTTCTCTCCTGCTGCAGGAAGCTTCCTAAAGCGAGACAGCACTTTCCGTGGAGCAAA
TAACGCCAGAGCGCAGATCCTCATCTGTGACGCTGGTATTCCGTACGACTACGAGTATCTCGGCAACGGACCTCGACTTGTGATTACCCCGCTAACCGAT
CGAATTTACGTGACTGCAACTCAAGCCCTTAACTTGCAGATGGGGTGCGCTCCTGCTGGTCCCGCTGGTACTGGTAAAACGGAGACAACAAAGGATTTGG
CGAATGCTCTCGGAAAAGTCTGTTACGTGTTTAACTGCTCCCCCGAGATGGATTTCAAGAGTCTTGGCAACATTTTCAAAGGTCTGGCATCGTCTGGTTC
ATGGGGGTGCTTTGACGAGTTCAACCGACTGGTGCCAGAAGTGCTTTCGGTCTGTTCTGTTCAGTTTAAAGCCGTGTGCGATGCTTGCAAAGCTGATGAT
GAACGATTTATCCTGGAGAATGATGAGGTGGTGCTGGACCCGACAGTTGGTGCGTTTATCACGATGAACCCCGGTTATCTAGGACGCTCTGAGCTCCCTG
AAGGTCTGAAGGCACTGTTCCGCCCCATGACTGTCATGGTACCTGATCTGGTGTTGATCTGTGAAAATATGCTCATGGCCGAAGGATTCACGCAGGCTAA
GATCTTGGCCTCAAAGTTTTACGGCTTGTACTCCCTGCTTGGACAACTCCTGTCGAAACAACTTCACTATGACTGGGGCCTTCGAGCGGTTAAGAGTGTG
CTGTGTGTTGCTGGTGCTTTTAAGCGTGCCGAGCCAGATATCCCCGAGACGGACTTGCTCATGCGTGCGCTACGAGATTTCAACATCCCGAAAATCGTAG
CGGAAGATATGGTGGTCTTCTTTGGTCTCCTAGGCGATCTGTTTCCCCGTGACAGTCCCAATGTGGACGTACGTAACGATCCCCCTCGTAAGCGGGACAT
GGAGCTTGAGTCCATGGTACAGGGCGCTTCAGAAGCAATCGGTAACACTCCTCGCCCTGAGTTTATGCTGAAGGTTGTGCAATTATCAGAGCTGCTGGCA
ATTCGCCACTGTGTTTTCGTCATGGGGCCTCCTGCTTCCGGTAAAACGGAGACATGGAAAACATTAAGAAAAGCGCGCGAAATCATGGGCACACCAATGG
AAGTGCAGGACTTAAATCCCAAGTCTGTGAGCACGAATGAACTATACGGATACATTGTGTTGAAAACACGCGAGTGGAAAGATGGCTTGCTCTCGCGTAT
TATGCGAGATCTTGGCTCTCGACGTCGGGATAATGGAGATGAAGATAATAACCCTAAGTGGATCATTCTAGACGGAGATCTCGATGCGAACTGGATTGAA
TCGATGAACTCTGTCATGGACGATAACCGAATGTTGACTCTGGCCTCAAACGAGCGGATCCCTCTGAAAGTTCACATGCGAATGATCTTTGAAATCCGAG
ATCTGGTGTACGCTACACCGGCTACAGTGTCTCGAGCTGGTATCCTGTATATTTCAACGTCGGAAGGCTACCAGTGGCGCTGCTTGATTGATAGCTGGCT
GGATCGGCACTGCCAACAGCCCGTTGACCACCGTTTAAGGAACATGATGTTTACTCCAGATACTCGTGCCAAATTTCAAGGGCTTTTCGACCAATATGTA
GAAACAACGTTGCGGTTTTTCCGTAAGAAGCTGGTTCCTGTGGTGCCAGTGGAGGAGACGACGCTGGTAACCAACTTGTTAAACATGATCGACTGCCTGT
TGACTCCTCAAGTGCTGGAAGACTACACTGTGATGCAAAACTCCTTCGTATTCTGCTGTGTGTGGTCCTTCGGATCCATTCTCACAATGAGTGACGATGG
TACGGACTACTCAGCAGAGTTTAGCAACTGGTGGAAGAACCAGTGGAAGGATGTGAAGCTGGTGGCTTCCGCTAGTAACACAGTCTTCGACTTCTGGCTG
GATCCGGAGACTTCCAAGTTCAATTCCTGGTCCAAGAGTCCGTACTTCTACACGGAGACGTACGTGTCTCCAAGTCCCATTAACCAGATTACTGTTCCTA
CGACGGAGACGGCTTCAATTGCATTCTGGCTTGAGAATCTCATCTCGAAGAATGTGCCGGTGATGGTGTGTGGGCCTGCAGGTACGGGTAAGACGCAGAA
CATCATGGGTATGCTGAAAAAGCTCAGTAAGGACGAAGCCACGGCTGCTTTCCGCTACTGTACGATCAATTTCAACTTTTACACCACGAGCGCCATCTTA
CAACAGACCATGTTCGGACAATTGGAGCGGAAAACTGGTATCAATCTGGGCCCGCCTGGCAAGGCCAAACTCATCTACTTCATGGACGACCTCAACCTTC
CAGAAGTGGATCCGTACAACACGCAGAGCGCTATCTCTTTATTGAGACAGGTGATGGAGTACAGACACTGGTTCGACCGTGTAAAGCTCCAGACTCAGAA
TATCCTGAACACGCAGGTGGTGTCTTGTATGAACCCCACAGCAGGTTCGTTCCTGGTTGACCCGCGACTCCAACGTCACTTCTGTACCTTTGCTATGGGC
ATGCCTGAAGCCCCAAGCTTGGTCACAATTTACGAGACGTTCCTCGGCGGACATCTGTCGAGTTTTGCTGATGAATTAAGCAACTCCCAGTTCTCTAATG
CGCTGATCAAGGCTGCACTGAGTCTTCATGCCAGCGTTGTGAGCACATTCCGCAAGACTGCGGCCAACTTCCACTACGAGTTCAATGTTCGCCACTTGTC
CAACGTGTTCCAAGGGCTGATAGCGTCCAAGAAAGACCGCTTTAACAGCCAGGAAAAGTTTGTTCTGCTTTGGCTACACGAAAGTGAACGTGTGTACGGC
GACCGACTTGTGTGCAAGGCTGATATCGAGAAGTACAACCAACTCGTACAGATGCAAGTGAAGAAGTCGTTCGCGTCCTGTAATACGAGTCGGTACTATG
CAGCCGAGAACTCGTGGCCTCTTATCTTCTGCCACTTTACGAAAGATGGAGACAGCGAGTACGATCAGATCATGGGCACAAACTTGGACGACCTCAAGAT
GAACCTACAGGTCCAGTTGCGGGAGTACAACAACAACGAAAACAATACAGCCATGCAGCTGGATCTGTTCGATGATGCGGTCAAGCACGTGGCGCGTATC
GTTCGGATCTTGAGGAACGAGAGTGGTCACGCACTGCTTGTTGGTGTGGGAGGCAGTGGTAAACGTTCATTGGCACGTTTGGCCTCGCACATCTGCGGCT
ACACTGTCCGGCAAATTACAATCAGCTCGAAGTACGGCGAGAATGAATTTAAAGAAGACTTACGTAAGATGCACATAGCTGTGGTGGAGATGCTGTCCCG
TAACGAAGAAGATGGAGGCGTGGTGTTCATGCTCACGGACTCTCAGATTACCAACGAGAAGTTCCTCATCTACTTGAACGATCTACTTGCTTCTGGTGAG
ATCCCAGACCTGTTCGCGATGGAAGATATGGACAACATCGTCAACTTACTGTCCCCTGTAGCTGGTACGAAAGACCGGAAAGAAGTCATCAAGTTCTTCC
AAGCTGAGATTCGTAAGCGTCTGCACTTGTGCTTGTGCTTTTCACCTGTTGGTGATGATTTCCGTAACCGGGCGAGGAAATTCCCGGCGCTTGTGAATTG
TACGGTTATCGATTGGTTCCAGCCGTGGCCGAAGGAAGCTTTGTTATCTGTCGGCCGTGAAAAGCTCAAGGAGATTGGAGATTTACTTGGGTCAGAAGAA
TCACGCGCTGGTATTGAGAAGTTCATGCCGTTTTCGTTCCAGTCGGTGAATATCTGCTCGGAAAGGTTCTTCCAAGTCGAGCGCCGACACGTGTACACAA
CGCCCAAGTCGTATCTGGAATTGCTTCAGCTGTACAAGAAAATCCTGCGGAAGAAAGTGGAGGAGTATGCTGCAGCTATTGATCGACTGGAGAAAGGTTT
GCAGAAGCTCAAAGAGACGGGGGATACCGTGTCGCGGCTTGAGGTGGAGCTGAAGGTCATTCTTGAGGCTGCTGAAGACAAGAAAGCAGTAGCCTCTGGC
ATTGCCGAGGCCGTTAATAAAGAGAAGGCCAACGTGGAAACAGAAAGTAAGAAGGCCGGCGACGAAGCTGCCAAGTGTGCGATCATCCAGACAGAAGTCA
CGGAGAAGCAGCGGTCTACACAGGAGGACCTGGCCAAGGCCGAGCCTGCTGTCGAGCAAGCTATGGCCGCTCTTGACTCGTTGAACAAGAAGGATCTGGG
CGAGTGTAAGACCATGTCGAAGCCTCCTGCTGGTGTAGATGACGTGTTCTCGGCCACGATGGTCCTGCTAGCTGGTGTGCATCCGAACGTTCAGGTCACC
AAGACTGGAAAGGTGAAGGATGTTAAGTGGGACACTGTGAAGAAGCAGCTTCTTGGTAATATCCCGGAGTACATCGAATATCTGGTTGGCTTCAAGCAAG
TGGTGGACGATGGTAAGGTGCCTCTTATGAACTGGAAAGAGGTGCGCGTGTTCTTGGAGATGGAGCACTTCAACTACGACACGATCCTTACAAAGAACAA
GGCTGCCGCTGGTTTGTGTTCGTGGGTTATCAACATCGTCATGTACTACGACATCGTCATCACTGTCGAGCCGAAGCGTCAGGCCTTAGCTGCTGCCAAT
CTTGAGTTAGAGTCTGCCAATGCTCGTCTCGCTGAAGTCACAGCTCTTGTTGCCGATCTACAGGCGAAACTAGACAAGCTACTGGCTGAAGCCGCAGCAG
CAGAGAAGGAGAAGGAAGATGCCATCAACGCCGTCGAGACCGGAAACCGCAAGATGAAGCTGGCAGGCACTCTGACGAACGACTTATCCAGCGAAAACGT
TCGATGGGGGATCAACGTGTTGCAACTTCAGAAGGAGAAGGATCTACTGGTGGGCGATGTGCTACTCGCTTCAGCTTTTATCTCTTATATTGGGCCGTTC
ACCAAGCCGTTCCGTGATGAACTGATCAACAAGCACTGGGTCCCGTATTTGCGGACTGCTGCCAATGGAGAGAGTATCGCTATGGCCGAAGAAGCTAACC
CGTTGCTGATTCTGACGAATGACGCGCAGATCGCCGAGTGGAACACCCAAAAGCTCCCTTCCGACCGCGTTTCAACGGAGAATGGCGCCATCGTGGTCAC
TACCGTGTCTATGGGTCGTCGACCGCTAATTGTAGACCCTCAGCTTCAAGCCATTGCCTGGATTCGAGAGATGGAGGCTCACAATAACCTCATCATCGTT
CGAGTGGGGCAGAAGATGTGGATTGAACGCCTCAAGACTGCGATCGGTACCGATGGCGCCTTCATGATCGAGAATCTGGGTGAGAAGATTGACCCCATCC
TGGCTCCTGTGATCCAGCGTTCGACTTCTCGACGTGGTGCGCGATACGAAATCCAGATTGGAGATGCGTCGGTGCCGTATAACGACAACTTCCACTTGTA
TCTGCACACGAAGCTGGGCAACCCGCACTACCCGCCTGAGATCCAGGCTGAATGCACCATCGTGAACTTTACAGTCACGATGCTTGGACTAGAGGACCAG
TTGCTGAACCTTGTCGTATCGAAGGAACGCCAAGATCTTGCCATTAAGCGTGAGAAGTTGATCCAGGAGCAAAACAACGGCAAGATCGAGCTGAAGAAGC
TGGAGGACGATATTCTGTTCTACCTAGCAAGTGCTGACGACGATATCACGAACAACCAGCCTCTAATTCAGATTCTGAGTGACACGAAGCACAAAGCTCA
ACGCACACAGAACAATATGGAAGCTGCAAAGAAGACCCAGGAGTCTGTGAACATCACGAGTGAGAAATACCGCAGTATCGCCGCGCGAGGCTCTCTGCTC
TTCTTCCTGATGAACGACATCAGCAAGGTACATTGCTACTACATCTACTCGCTTGCATCCTTCCAGCAGGTCTTCTTGTCCGGCATCTACCGCGCTCCAC
CGGCGAAAAATCTCGTTACCAATGAAGCTGAGGGTGCAGTTGAAGGCGAAGCTACTCCTGCAGCTGAAGCTCCCGCAGCAGCAGAAGGTGGTGAAGGTGG
CGGTGATGATGAAGCCGAGGAGACGGAGCCTGCTGTTGTGGATTTGACCGACGAGGAGATGAAGGAACGCTGCCAAGTGCTGATGGACAGCATCACCTCG
TGCGTTTACAACTATGTTCGTCGTGGGCTCTTTGAGCGCAACAAACTCACGGTCGCGACGATGCTGTGTCTCAAGATCTTGTTGAGAGATGGTTTACTTA
GTGATTCAGAGGTCGAGTACTTCCTTATCAGTAAGGCTCATCCAGACGCTGGCAATGCTGGTTCAGCTTCGGAGTGGCTTCCCGCGGCAATCTGGGCCAA
GTTGAAGGCACTGGAGAGCGCAAAGGCCTTTCAAGGACTGGGAGATGGGATTCAAAACGATCCCGATGAGTGGAGAAAGTGGTTTGCAACTGAAGATGCC
GAGAGACAGAAGATCCCAGGGGACTTTATCAAGTTGACCGCTTTCCAGCGCCTAATCTTACTTCGAGCCATGCGACCGGATCGAGTGACCAACGCTTTGC
GTACGTTCATCCTCGAGTCCTTAGGCGAAGAGTACGTGACCCAACCACCGTTCAACATGGATGCGACGTACGCAGAAACGAACTCGAGCATTCCGATCTT
CTTCGTGTTATTCCCTGGCGTGGACCCTACGCCGTGGGTCGAGACCCTCGGTAAAGCGAATGGTGTCAGCCTCGAGAACAACAATTTCATCAATATTTCC
ATGGGACAAGGGCAGGAAGCATACGCAGGTGATGCATTGAAACGACTGAGTACGGAGGGCGGCTGGATCATCTTGCAGAATGTGCACTTGATGCAGTCAT
GGCTGCCGACGCTGGAGCGTCAACTGGAAGAGGTGGCAACTGAAGGTGCTCACGATCTGTTCCGATGCTTCATCTCAGCTGAACCACCTCCATTGCCCGA
CATGTTAAACATCCCTGAGTCACTACTTCAGAGCTGTATCAAGGTCGCTAATGAGGCTCCGTCGGATATTCAGTCAAACCTACGTCGTGCGTGGGCGAAC
TTTGGTGAAGATAAGGTACAGGCATGCACGAAGCCAGCGGAGTTCAAGGCTTGTCTGTTCTCGCTCTGTTGGTTCCACGCCATCGTACTGGGCCGTCGAA
GATTTGGGCAACAAGGTTGGAGTCGTGCCTACAGTTTCAATACTGGAGACCTCACTATTTGCGCCAATATTCTGCACTCGTACCTGGACAACAACGCTTC
TGTGCCGTGGGATGATCTGCGCTATCTGTTCGGTGAAATCATGTACGGTGGACACATCACGGACGCTTGGGATCGTCGTACAAACAACACGTATCTGACA
GTTCTCATCGACCCGGGGCTGCTCAGTGGAATGGAGCTTGGTCCAGGGTTCAAGTCCCCGAATCCGCAAGAGTTCTCGTTTGCAGACTACGCCAATTACA
TCGAGAAGAACATGGTTCCCGAGGCCCCGCCGCTTTTCGGACTCCATCCGAATGCTGAAATCGGCTACCTCACCACGACGTGCGAGACGTTGTGCTACAC
GATCGTGACGATTGGAGGAGGTGCTGGAGGCGGCGGAGGCGAGGAAGGAGGAGGTGGGGACAAGACGGCAGCTCTACGTGCGTCCATCGACGACTTGGAG
GCACGTTGCCCTGAGTTCTTCAACATGTTGGACGTGGTGGAGGCTGCAACGCCGCACTTGACTGAAGAACACGGACCTTTCGTGGTGGTGGCATTGCAGG
AGTGCAGTCGAATGAACGTGTTACTACAGGAAATCCGGTTATCGCTTGGCGATCTGAAGAAGGGTCTTAACGGACAGCTCAATATGTCACAAGCCATGGA
AGACTTGGCAACAGCGATGTCACTGAACGAAGTGCCTGGACGAAACCCGTTCTCGCAGTGCAAATGGGAGAAGAAAGCCTGGCCGTCAACCAAGTCGCTG
AGTGGTTGGTTTTCGGACATGGTGAAGCGCCATGAGCAGCTTTTGATGTGGGCTGGAGACACGACAGGAGGAGGCGGGAGCTGCTTCGTCACCCCGTTCT
CTATTTGGCTGCCGGGTCTCTTCAATCCGACGGCCTACACGACGGCATGTCTGCAGGTAACATCACGTAAGCGCTTCATGCCGCTTAATCAGATGACAGT
GGAGACCCATGTGACCACGATCCAGGACTCTTCGACCGTCTCGTACTACCCTGATGATGGTGTGTTTGTGCACGGACTTATCCTCGAAGGTGCACGATGG
AGCACACTGGATGAGATCAACGAGCGCTATCCAGTTGGTGCGACGCCGCCTACCGAATGTGGTGGTACGTTGCTGGATAGTAACCCGAAGGAGCTGCTCT
GGAGCATGCCTGTCATCTACGTCAAGGCCGTGACCACGTTACCAACATGGGAACCGTCCTCTGTGGGCTACCTGCGCCACGACCCAAACACCTACGAGTG
CCCTGTGTACCTCACCCGCTTCCGTGGCCACACGTACATTTTCTTGGCGACACTGCCGACTGACTGCGGCAGTTCCAAGTGGGTGTTACGTGGCGTCGCA
CTGATCTTCCAAGACGACAACTAGTACATGTACCTGTTGATGCTTTTGTATGTACGGCGTTAGCAGCAAAAGAGAAGAGATGCATGTAACCAGAAGGAAT
GATCCCTTCACAACATAACCAAAGTCTATCCAACCTTTCATTTCTCCTCCTTCTCCTTCTGCAGCGCCAGCATCTTCTCTAGGAAGCTGCCGTCGTTCGG
AATCTCGGGGACACCTCCCGGCGTGTCGGGTACCTGCTCCTTCTTATCTTCTGTAGTCTCCTCCTTCTTCTCCTCTTCCTGCACTGCATCCAGGGCCTTG
GCTTTGGATCGTTCCTTGCGTCGTCGCCTTTTCTCAGCGCGCTTTTGCATCTTGGCGTCGAACTCATCAGCACTGCGCTTGCGTTTGTCTTCGAACTCGC
GCTGCGCCTTGTTCTCCTTGTAGCGCTGCTCCATGGCGGCTACGCGCTCCATCTCTCTGATAAATAACACAATAATAAATCATCACACACTTGCAACTCA
TAACTAGCTATTATGACCATCGATCGCACCGTCTTCTGGAGGCGCGATAGGTGTGAAAGTCGCCGCTGCCGGCGCCCGCAGAGCTGCCGGACACGTTGTC
CACGCGGTTCACGTGGAGCTTGTCATCCTTGACACCACTGACAGGTATAGCAGTTGCAGAGCTCTCTGATGCCGCTGCATTGTACGCCACGGCGGCGCCC
TGCGCATCCTGATCGCTGAAGGTTTGCGTCGTCGTATAGCGGCCCATTGATATTGATAACTTTGTAGAAAGCCTTTTTCTACAAAGTATAAATAAGCTTT
TTAACAAAACAAATATGTACGAAAAAACACAATTACACAAAAAAAATGTTTGTATATTTTCGCTTTTTAGTTTACCGGTACTTTCGGTAGTACCGTTCTC
GTACCGCTTAGACGGGTGGCGACAATCGCATTCTGCGGCCAGGATCAACGCGCTTGTTGGTCGGAAGTGGATCGAGTGCGTCGCTAGGGAATCATGAGCA
AGATTGCACAGGCCTCCAAGGTGGCGTGGCACGTAGTGGACGCCAAGGGCCAGGTGCTTGGTCGCCTGGCTTCGCAGCTGGCGCCAATTCTGCGCGGCAA
GCACAAACCCACGTACGCTCCCAATGTGGACTGCGGCGACTACGTGGTGGTGATCAACGCCAAGGACATCGTGCTCACGGGCAACAAGTGGAACAATAAG
TTATATCGTTGGCACACGGGCCACCCGGGCGGCCTCAAGCAGCGCACGGCCAAGGAGCTGTTCGAGCGCAAGCCCGAGGACGTGCTGCGCAAGGCTGTGT
ATGGCATGCTGCCCCGCAACCGCATGCGTGCGCTGCAGGACAAGAAACTCAAGATCTTCATGGGCGAGGAACACGACTTCGTTGAAGAGGTGGGCCCGGA
CCCCGTTATCCTGTAGGCCAGACGCGATATAGACAGAAGAGGAAGCACGGAGAGGTTGGTGGGAGAAGGAATACACGGCTGGTGCACCCCTTATTGCTTG
TGTGTGGTTATTGTGCTAGGTCCACAGGGGCAGCTTCATTGTCTTCGTTCTGTTGCTGTTGCAGGAGTTCGCGTTCGTGCTCTTGTTGGTGTTCGAGTTC
AAGTTGTTGTTGAAGTTCGAGTTCCTCTCGAGCTTCGTCTTCTTGGAACTGTTGGAGCAAGTCTTCGCGTGTGCTCATGGCCGTGAGCAGAGCCTCGATG
TCGACGAACGCCGACTGTTTCATGGTGAAACATGCAGCGATCTACCACAGACAATCACAGATTAGAACCATGCATTACATGGAGTTACAATTACTGTACC
TCTGCGATGACGTGTGCGGGACATCGACGCCAGACGTCTGGAAGCGCATCGGGGAGCGATGCCAAAGCTGTTATCGTCTCCACTAAAGTGATGAGTGGGA
GAAGTCCCGAGTTGTCGATGGTCTGAGTGATCAAAGCCTCCCGAAGATCATCCCGTTGACGAGGATTTAGAAGCAATTCGTGTGTTTCTTCAACAAGTGG
CGGTGCATCAGGGGGAGATTGAGGCAACAAGCGTCTACCCCCATCGACCCACACCATTGTATCTTCATGCAATTGCACTGTTGTCGGAAACCTCTCGACG
AATTCAGGCTGCAAGCATCAAACAATTAGCTCCTGTAAGGCAAAGTCAAACTAACGTGAGAACACGTACGCTGACATCAATGAAGATCGGAAGTGCGACT
TCCGCCTCGATGGCGGCACGAACATATTCAACAACAGCAGCCACAGCCGCTTGCTCTCGGTCTTTTCGATCTTCCAAAACGTCTCGAAGTGTGATCTCGA
TGGAGCGCATGGACCGCGTGATTTCATCACAAATTTTCTCGGTAGCTTCTTGAAGAAACCGTACTCGCCGCTTCATCAACCCGTATTCATACTTGATCCC
ATTTAGTAAATTCACTGTGCAGGTCTCCTCTTCAGCCTGCTCATGTGCGCCGACAATTGAATTAATTGCTTCCATCCACGAACTACACCGCTGAAGAACA
TGTGTATACTCTGCCAATAGCTCAGTCAATGTCAGAGACTCTGCCAAGGCGTCTTCGCTAGTTGCAGCGGTGTTAGTTGGAGGCACTACGGTAGGGGCAG
GTGCTTTCGCTTTCCCCTTCGGAGCAGCTTTCCCTGTTGCAGCGGGTGCAGATGGAGTTTCTACTGGGATTTCACTTGTCGGATCGCGATAAACTCTGCA
CGCCACCTCCAAGCGAGGTTGATGAGAGTGCCAAATCTCCACAATACTATTGAGCTGAGACCGATCACTACTTGCAGCGTAGTGGCCATCTACAAGAATC
TGGATAGACGTTCGGAAGCGATCGCATTCTGCCTGAAGCGCCATTTGATAAATCGCAGCGACGTGCCGGCACGTGTCTTCAGTCCATCCATCGCCAACCA
AGCTACAAAGCTCCTCATCGTTCTGTGTGAATTTCGACTCGACGAGAGATCCCAGTTCGTCCTGCAGAATATCTGTTCGAGCATGGAGCTCGAACTTGGT
GAGATCGTTAAAGCGCATCTCATCGACCACCTCATTGAACTGCCTCTGGAACACATTGACAAGTTCTTGTTTCTGGTCGGGACGCCGTATAAACTCACAA
AACTCGCGTGCCATTATCTGCGCGCGATCGGTAACTCGATACCGCTCTTCCCGCAGCAATGCAAAACTTGTCTTCATAACAGCAATATACTCCACTTCCA
TGTCATTCCACAATGCTGTCAGACCCCGAGCTGTTGCTGGCACCAACTCGCCAGAGTATTTACTACTGGGCACAGGGCGACAGGACCTCTCTTCTTCCAT
CCAACTCTTTACAGCGGTCAGGACACCATCAAGATGACGTTGGGCTTCTTCCAGCTTTTGCCGAATCTCCAGAATCTCTTCTTTCTTTGCCTTTGCTTCC
TCTGCTTCCGTCACAGATGCCTGCGTTTTGGCCACATCCACCTCAGCCTCGTCAATTTCCGAGACGAAAGCGTCCAGACGCCTTTGCCTTTCCTCCTCAC
TCGCCATGAGCGCCTGCTCCCCTGCTTCTAGCTCGAACTGCTTCGCATCCGCTTCCTCTTTTTTCTCATTGAGCAAATTGGTTACAATGTTCGCAATTGT
GTCATGGATTTCACTCACAGTCATGCCAGTGTTGGGAAGCTCGTGCAACGTTTTGAATTTGGCATGCCAAGATTTGTGACCACGAGAAAAACCATCGTTA
GCCAAGCAATGCAGCGACAAAAGATCACTTGCATACGCTGTCGGGTTGACATGCTGTAAGCAATGCCGTACAATTGAATCGTCCGGAGGTGGGTCAAAAA
CCAAGTGATTCTTGTCTCCCGTCGTGATATCCTCAACTTGACCCAGGCATCGATCTAACACCGTGTTTGTAAGGCAGTCAATGTGAAAAACGAGATCCAC
ACCCGCTTTGCCGTGGAAAAATGACGGCGATAGTGGCGGTTTACTTCGACCGGGAGCAATGGGCGATTCAAAGTCACAGGAAGAAGGAAGAAGGGCCGGG
TCCATGTATCCAGTAAGACGTTCCTCCAAACTCTGGCCATGGCGCTCTGTTGCAGGAAGGTCGTAAATCACCCAGCCAGCTTTGCTATCGGTATTTTGCG
CAAGGGTTTGTGATTCAATCTCTCCGATAGATTCGATCACAAGGCGGCTGTACAGCTCTGGAGGAATTTCCTTCCCATTGACCAGGAGACTTTTTAATAC
GCGGCCAATGTCACTTGAGTTTTGAACCGCACTTTGTATCAGCTCGTGAACCGAGAGCACGGACAAGTTATACGTTTCGCCTAGAAGTTTCGCTTGTGTC
TCTTTTCCAGCGAACGGAGGTCCAAAGACAAGAATTCGGAGATGCTGATGAGGTCCCAACGAAGGTTGAAACGATACTGGCACGCTTGGTCCTGTAGTGT
CTTGGAGTTCATCCTTTTCCAACGTGGTACCGGCCTCAGAACTTGACAAGTAAGTGATCCACCGCAACGACCTGATTTCTTCTCCAAGGATAAAACAGTC
CTCAATGACTTCTTCTGCCCCAATGAAAAGAGATCCATCGTTGATCGTTGTCAAGGGAGCTTGCTGTTCACTTGTCGTTTGGAATGGCAGGAAGCTTGAC
AAGTATACTTCCAATTCGTGCTTATCCAGTATTTCAGCCTCATTTGAATGGTTTGCAGTAGGAACAGGAGACGTTTTGCCAATATTGCAGCCATTCGCAA
ACTTAATCTTGTACTCATTCCATGTCTCCGCAGTCAGAAACACGGAGGGATCTCTAGAATGCAGTGTCTCCTCCCGTTTTCCAGCAACAAAAAGCATGAA
CTCCACCATATCGTGCATGATAGCGCTGGAAATCTCCTCACTAAGAAAACGATCAGCTGCTTCAACGGATACCTGAACATTCTTCTGTTGTATAGTCTGC
ATTTCGCTGTCATCCTCGAATCGAAGGAGTAGATTGTGATAGCAGCCCGTATCTCGATCAATCGCCGCTACAGAATCCGATTCCTTTTGGTTCATATACT
CTTGATTTCGCATCGACCTGTTTTCCCGAGCTACTTCCTTGTAGATAAGTATTCGGTCCATTTCGCCATGCACATCCTTTTCGCCGTTCGTGTCCCGCAG
CACTACGCTTTCAAGGAGGCTGGCAACACGAGCAGTTCCGACTCGAGTGTGAGAGTAAACGCATTCTTGAACGAACCGCTTTCTCCTACGCGACAAGTTT
TCCTTGCGTTTTTCACGTTGCTGGCGTTGCTGTTTGATAACACTCGCTGCGCTTTCCATTTCCAGCACGTTCGCATAATAAAGCTCCCTTTCATTCATCG
AGGACCCTGCCAGATTTGAAGTCGAATATTTCTTCTTGTCTGAAGATTCATTGAGCGCTGTCGTGAGCGAGCGCAGACCGTATCCAGCTGATTTGCGCGA
AGTAACCTTTCCACCTGCAAGCGAGCTCTTCGATCCTCCTTGTGCCTGCCAGGAACCCACCAATAGTCAGCTCACAATGGAAACCATCCCAAAGCTTTCA
GAGCACATACATCAAAATTGTCGAGATCACTTCGCACTTTTTGGCGCAGGCTAAACGTGAGGTTTTCCTGTAATGATATCGAAATTTGCCGTCAATAACC
GTAGTATTAGACGCTGCCGCAGATTGCAAACCTCTGCTTCTTCGCGTTTCTTCATAAGTTGCTGAAAAAAAGCAGCCCGCCGCTGTTCACGGGCACTTTT
CTTCTGCAGCGCCAGTCTCCATGCAGGCGAGTCTGTTTCTTCGAGAGCTTCCTTGATGAAGCTGCTATGAATGTAAGCCCGATGCAATCTCTCTGCCTTT
GTCGCCTCCAATACCTCTCTCTGCTCTGCCATTTTCTCCAGGTACGCCGCTTTCTTGTTTGCTTCGTCCACAATTTGATCCCTGGAAACCGAAACACCTC
GTCACAATTCTCAAACATCGCTCCAATTGAACATCTCAGAACTCACTTTTCTTGTTGTAGCGAGGCAGTCGAGCGTGCATGCCGTCGAACAGAGTGTTCG
AATAACCGGAGCTTTTCCGTATCATAGGCTGGCTTCGCCAGCTTGACTGGTCTGTTGTGTAATGGGGTGATCCCCGTCCGCTCTAACGACTTGGTCGAAA
CGGCAGGTGCTCTACCTACTCGAGAAGCAGCGATCTAACAGTACAAAATCAGCTTATAAGTTAGAATTCCATTGCTTTTGTAGATTTTGAACTCCACACC
TTTATCTGGTACAAAAGGTTGGCGGCAGCGTCCTTCTTCTCGTTCATGATGGCAGCGGCCACGTTTGCGTCGAATTTGACATTGAGGTTGCGTAGCGTCG
GCTCTAATAGGCAGAAGTTGATGATCTTAGCGTCGGCGGTGGAGCTGCGCATGAAGTCGGCGAAGTTGTGCTGGTGGTTGAGGCGGTGCAAGATCTCGCC
CAATAGGAAACCGCTGGCGAAGTCCATCTCCACGTTCGTCACGTGCGTCGACAGCTCCAGCTCATGGTTGATCCAGCGCAGCAGCAGTTCCGCCATCACA
GTAGACGCAGTCTGCAATGGAGAGCAGTAGACAAGGACTAGAGCAACGCGTGAGCTCGATCCGTCGGCGCTGGCGATTCCAAAAGACGCGCATGTTGAAG
TCGCATTGTGTGGTATACACAATCAGTTCGTCCTGTATTTTGTGTGCTGGACACAAAGTACACTGTACTGTAAAATGGTTAGGTGTGTTAGTTGAAGCAG
ATGTTCGGATGCGTCGAACATAAAAAGCCTCTGCGTGCGATCACCTTTGAGCACTTTATCCCAATCACGGGAGCTCTAGCGTCGCAGGCTCGATTGCGCT
GTGTTGGACACTGCGTTTATTTGTCGGTAGAGCCTGCAGCACTTGTCGTCCTTGTGATTCACAAGTTGTGACAGTGGTGAGAGAAATCGCATCACCGGCC
ACTGCGAACGTTTGGAAAATGCGGCGCAATCGAGCCGTTGATGGTCACCATCCTCTGAACCGTTGGGTATCTCTTTATTATACCTAACGCCAGATTTCAA
CCCAGCGGCTCCATTTGCAGTACACATGCAGTATATCATCCTGTGGCAGCGGTGCACTGTGCGTATATGAACGGAGCAAAGTGACTGAGCGCTCCAACGA
TCAAATGCCTGCCCGAAGTCCGGGCTGGAGGGCAGCAGATCAGGTTACCAACGTGGCGCACAGTTAAAACCTTTAAAACTTAATCAGAACAAACCTGCAG
AGCTAGAAACTGCGTTCAACCCTAAACACCATCGCCCGATCACCTTCACTTTCTTCTCAAATGGCGTTGCGTTGGTGCTGCAAATGTCGGCTGCGCCGTT
GGCCGCCAACTTGGCGTGCGAGCGAGACATCCAGCGCCGCCACCAGAGTCGAACTTCGACTCGAAGCCATGAATAGTGAAGCAGCAGCAGCGACAGCATG
TCGCCAGCAAAATCCCAACGCTCAATATAGCAGTGTTGAAGTGACAGCTTGCCGGCCAAAATGAAATTATCGAAGGACACTTTTCGCCTATCAGTGCCGA
AAACCTGTGAAAAACGATATTTCACCGTGTCTTTGATGCGCCAAGTCGATCGCAGACGCAAGCGATTGCGTCCCAGAATCGCTTTCGCCTCGCGCTGTCC
ACCATTCCGCGGAATCCCGGCTCGTCGCAGAGCGACAAGTGCAGGTTTCCCCCATTTCGGCCATATCGTAGTTTCCGGAGATCTCGACTGCAGTGAGAGA
CCCACCCAATATTTCAAGTGATACAAAGATGGCGGCCGTCGAGAGATCGAGCGCCCGCTATTCCAAGATGATGCCTTCCTACTCTGGCAGCGTGTCGGAG
GAAGACGACCCTAGTCTCTCTGCTGAAGACGAGGAGGTGGACGAGACGTTTCTAGCCCTGCAGAAGCTGCTCAAGGCTCTCAACCGCACCAACCGCGGCA
GCATCAGCAGTAACAATGGCAGCTTCCTGGGAGGAGGTAGCAACAACAGCACACATGTGGTCCCCACCACTGACAGCACGAACCAACAGCGCTTGTCGCG
AGAGGAGATGCTTGAGAGCCGGCGACAGGAGCGCGACCGCTTCCGTCGCTCGCTCTTTGCCAAGAATTCCAACACTCACCACACTCGTCGCCGCCGCACG
TGCCCGGCCTACTACTGCTCCGAAGAGGAAGAGGAGGAAGAGGTGTCAGTGCCCTCCGTGGAGAGCACCATCTCGAACAGGTTCATGAACGGATCCTTCT
CCAACCTCAACGTGCACGTGATCTCGCGCGATCGATGGTCGACTGAAGACCGCGTCATAGAGCGCCTCCCGATTGTTATGCTTCCCAAAAGCGGCAAGAT
CTCCATCCCCACAGACAATGAGAAGATCGACGTCGTGCAGACGGATGAGTTTATTGACTTGCGCGAGAAGCTGGTGGAGAGCATCCCAGAGGGAGCTTCA
ACCTTGCACTACCTTACGCCGCCACGCTCCACCTGGTACATGCAGATGCACAACTTCGAGGAACTCAAGTGCTAGACACGGCAAACAGCAAATGAGCGTC
ACCCATCGAAAGCAATGGCGGAAGCAAAGGGCGAAACACATGCCGCAGGAGGCAGAAGGAAGCGAAGGAGAAGCTTTCTTGATGCATATCCATTGCCCTG
TTGTGCCTTTAAAAAGGATAATGTATTCTTATTTAAGTGACTACCGGCAGGCGTAGTAAGCAAACAATTTTACGAAGATATTATCGATCAATGTGTGTGC
TCCAGTCACTTGTAGTGTATTTCGACCCAGCAGCGCTTGCTGACAGTCTACATAGTCTAGTAGACTGTCTACAGCTCGTCGTCGCTGGGCGCCAGTGCGG
TGCGATATTTCTCGTAAGTAACGAAAAAGACAACGCACCAGGGCGCCTTGCGCATCCAGTTCGGGATAAAGCCCTTGTAGAAGGCACTCGCGCCGCCCTC
ATGGAAAGTTTTCCGCACACAATCCATCATGCCCTTGTAGTGGAGCCCCTTGCCACTCGCGTCGGTCGGCTGGCTCATGAGACGCGTCTTCACCACGTCG
ATCCTGTTATTACATCACAACATCAGTAAGTCTCAACACCTTTGCCATACAACAAAGCCAAACTACGTACGGGTTCGAAGCGGCCGCGCCGGCGAAACCA
GCCACGCAGCTGGCTCCGGTATGAGCGAGCACACCTTCCTTGAGCAGTCCTGACGAGATCAACAGCTCCTTGCTGTGGTCGTACGTGCCCAGTTCAGCAG
CGTTCACGATGAAGCCGCGCTGAATATTGGGCGGCATACCACGCAGAAACCCGCGGAAGCCCTCCCGCTGGTAGATCATGCTGAAGGCGTCTCCAATACC
ACGGTAAAGCTGGCCCGAGCGGTCTGCCTGCATCCGCACCTTGATGACATCCACGCTGCAACAATAACACAAACATTAGTCAACCAGTTCTGCTCAATAT
GAAGAGAGCTGTCAACGTACGGATTAGCAATAGTGATGCCAATGGCGCCAGCGCAACCGCCAGCCATAAACTTGTTGATGAAGGGCACTTCACCGTTGGC
ACCCTGAGCTGCATTCGCCCCGAAGAAGTTGCGTAACGGCTCATAGAGCACCATGCAGATGCTCGTGTACGAGACTTGACGCAGCAGTGCGGGTGTGGCT
CCGTTCCAGAGAGCGCCGGGGCCCTCGTGCTTGATCATTGTCTGCGCAGCGTGAAGCATACCGTTGTAGTGTACCGCCGGCTTGCCACCCGTCGTGGGGC
CTGAACGCTGCGCCTGCAGCCGCACCTTGGTGATGTCAATGGGCAGCGTCAACAGCTCGGCGGTGGCTGACGCCGCGCCGCCAGCGAGGAAGCGCGTCCA
CTGCGGCTCGATCGCTGTCTTCACCTGGAGCGGGGCCTCCTCCTTCACACCTGCTTGAGTCGCCATCGTCTTCAATAATGGGGATTGTGTCGGGCAAAGT
GATGCTATTAAGGGCTTGTGGGGACTCGTGCGATGGAGGAGGCTGCGAATCCGAGAATGGACTGCCGTAGACCTCAAATTCGAGTCAAAAGGGAGGTGGT
CACGGCTGCTCAGCAGCCCGGAGAAGAGGGGCACATCAGGATCTGCTGGTTCTTGACCGTCTTTGCGCAGGCAACCACCAACATGAGGTGTTGGGGACGG
TTAAAGTTTAACTTAAACGGCCAGCAGCGAAATGGGCTTGGCTCTGTTGCCCAGCCCATGCAGCCGCATCTGCTTGCGAAATTTGCACTTTGTATCAAGC
TGCGATGCGAGATTTACGCGGTTCATGCCTGGCGGACATTTCGCTGGTGACCACAATCCAAGCTAACTCAAGAGCGTCTCAATGCGAGCCACTGCATTCC
CGGAGGAGCCCGATAAAGCGAGCTGGTACTGTACCGACCGCAGCGTAGCGTAGCCATTCGCTGATGAAGACGCCATCCCTGTGCGCGACTGCCAAGATGG
CAACAGAGCTCAGCGGTTGTGACAGCTGATCCAAACGACCAAGCCAAGGTGACATCCAGCGAAAAGAGCAGCAGCCGTCGCCTGATGCAAAAAGCACGGA
GGTGGCAGCGACTCGTAACGAGGAATATGGAGTGGATATCCAACCGATACTTGCAGCAACTGGCAACCCTTACCGGAATCGCGCTTGGAGAGAGACATGC
TTGCCATACCCTGGATAGATCTAGTGATTTTTCGATAAATCTATAGTTTTAATTCGACCTTAAAGGGCTAATTATGCCTTCGTGCTACGGGCATGGCTCA
CATGTGCCTCATTTCGTAATACGTGTAGTCTATGAGCAAATACACTTGCGAACTGTTGCCAAAGGCGACAGTGGCATGAACATTGAAGACTGCAAAACCT
CTGTGCAAGCGCTTTGGAAGAACATGATATTTTTGTCTGTTCTCAAAAGGCGCTAAAAAGTGCTTTTTTCTAGTGTCCAACTACACAAAGAGACAGCAGT
TCACCACTATCCCCTCCCTGACTGCTCTGATCATGCGTGTGCCAGCGTTCCTCATCGCGCTCTCCGCGGCCGTCGCTCCCGCTTCCACTGCGCGCACCAC
GGATCTCTCTCTTGGCTCCTTCGTCAACTGTCCTGCTGTGCGCTCAGCTGAGTCCCGGTGCCTCTGGGCGGGCGAGAACGGCGAGATCGTCGACTCGAAG
AGTCTGCGAGATCTGCTCGTTCAGCGCAGCCTCGTGTCCTTCAGCGACCGTGACCGCCTCACGCGCAACCTGCAGACACACATGGCGTACATCGAGGACG
TGCACATGTACGCCAAGAGTGTGGGTCACGAGTTCTCGTACAACATGGGTGTAAATGAGCGCCACTTGACGTCGTCCACGAGGCGTCGCCTCTCGCCCCA
GCAACTTGTGGATCAGGAGGCCAAGTCAGCTCGCTCGCGTCGTCTCAGATCTGAAGCTAGCGGTAGTACGGCATCCACTACCAACACGGTGTCGAGCTCC
GGCAGCTCCGAGTACTGGAACTGGTGCGACACGGACAACTCGTTCGGCTACAGTGTGTGCTCGTCCGTAAAGAGTCAGCAGAACTGCGGCAGTTGTTGGG
CCTTTGCTGCCGCTGATGCCATCGAGACGGCCGTCGTCATCGCCGAGAACGCGTCCGCGGCTGTGTCTCTTTCGCCTCAGCAATTCCTGTCGTGCAGTAC
GCTGGAAACGACGCAGACTTTTGACTACTGCTGGGCGTCCGACAGCGGCGTGACCGGCGCGACGTGGATGGAGACGGAGATCAAGTGGGAGTCGCAGAAC
GATGGCTGCAATGGTGGTATGACCCACGGCGCTTTCATTGACGCGGCGCAGAACTCGTGGGGGCTGGTGACGGAACTCACGATGCCGTACGATGACTCCG
GCTCAGGAAGCACGACTTCGAACAACGAGTCGTCAGCGTGCACTGTGAGTGCCAATGAGACGGCCGCCAGCATCACGGGCTGGGAGCAGGTTGTGGGCTC
GGACTGCACAGCGTCGAGCAACTGCACGACCTTACTCCGCACTGCGCTGGAGAAGCAGCCAATTGCTGTGGCGATCAACTCGGAGGACCCGTTCGGCGAC
TACGCCGGCGGCTTCTACAGTTGCCCGAACGATGGCGTGCTGTCTTCGAAGAACGACGTCAATCACGCTCTGGTGCTTGTCGGCTACGGCACTGATGCTA
CGGAAGGCGACTACTGGATCCTCAAGAACTCGTACGGTAGCTCGTGGGGCGCGAGTGGTTTCATAAAGCTGGTGGCAGACTCCAAGGTGAACTGTGGCCT
GGACATCTTCCCCGTCATCCCTACGGGCGCTTCAGCTGGTGTTGCAGCTAGCACAAGTGTTGACAGCGGCGGCGACAAGCTCTTCGTGGGCCTGAGCCCC
ACAGCTTGGATCGTTGTTGCGGCGGTGACGACTATTTTCACCATCGTGATGACTGCCGTCGGTATGCTGATTTCGCAGCGAAGGCTCAAGACGATCAGGA
AGAAGAACTCGGACATGTACGCCAACCGTGCCCCAGTGAACGCTCAGCAGACTGCTACAGCAGCGCACTAGGCTCGTAACGTGCGGGAGCTCTGGTGGCA
GGATTTTGTAGCTTCATACTTGAGTCAAACAATACAACACAGCAATGTTTAGCAACGCGTACTGTACATACCGTAAACCAGCCAGCTTATCAAGACGGCA
AACACCACCAGCGCTTCTTCTCTTCTCGCCAACCTGTAGGAACCGTCTTGTAGGTACAATTCTGTCCACCGATAGGTTTACGGTTGGACTCAATATCCAG
CCCAATTTCTGTCGTAAACTCGACCGCAGGAGGTCAAGTTTCTCATATCAATATTTGCCAGCTCAAGCGGAGTCGAGATGTTGCATGCTGTTGTGGCGTT
CACTGCGGCCGTAGGAGTCATGGGCGTTGTTGACGGTGCCAGGACCACAGACCGATCCCTAGGCACCTTCGTGGGATGTCCTTCGGCGGAATCTGCGTGC
CTTTGGGCAGGCGAGAACGGTGATGTGGTTGATTCCCACGCGATGCGTGAACTTTTTATCCAGTTGAACAATGCTGGCACCAGCAACGAGGAAATATACA
GGCGCAACCTGCAGACACACATGGCGTACATCGAAGGTGTGAAAACAATGCTCTGGTTTGATACGTGC