Description :
From Genome Similarity Track
Location :
contig_122:67286- 70466
Transcript NameFunction/comments
g13995.t1hypothetical protein

Sequence
3180 bases(100 bases per row)
ATCAGAATATGACTGCCTATCTACTACAGGTGAACAATTGGCTCAATCGAATGTAAAGTTAGTCTGGAAAGGAAGCCTCGGCGTGGTGCGACCTGAACCA
AAAGTAATTCATCCCGGGGGAGGCCATAGCCGCTGTTTCCTCTAGGGAGTCCCCTCCTACCGATACCCGCATACTTACTGACTGCAACTAAGACTGCGGC
CGTGTATGCCTCGAGAGTTCCGACGATGCAGTCTGGCGCTCGTTGGGGTAACGTATAGAGCGACACGCAGGGACGCTTTACCGGTGGTGGGGATTCTGGC
AAGTATTTCGGCGGTGAGTCTGTTATTCTAGTGGGTCCACTCGTTTGCTGCACACCAAACAGCGAGCAACGAACTGGGCCCGCGCCATATGAAGAATGTA
ACTGGTAGTTGCGCATGCTCTGTTGGTAGGCACCAAGTTAAACAGCAGCGATTGGCCTCGACTGCAGGAGACGAGTTTCACGTTAGCTCGCCGGTAAATG
CGCACTCGATTCCAAACACCAGCCACCACAGCACGGTCTGTGCTACAGACGAGTCTCTACGTCCACACTGATCCACCACTGCCAGTCAGCCCAAATCGAA
CTTTTCAGCCAGCCAGCAAGTATGTATACGGCCGAACGAGTCAAAACTTTCGGTGTGCGCGGCAACGAACTCGCCAACTTGCTTGCTTGGATGATCTACG
CGAAGCAAAAACACGCGACGGCGAGTACGTACCCCCTGCCGGTCGGCCCATACAACGACCAAGTCAACCAGATAGAAACGGCCACAGCCGGGCCGCTCGA
CCGAAATTAACGAGCAAGCGTAACCTTGAATAACCTGCGCTGTCACACCCGCCGATCAAGTCCAAGCCGACCGATTGAATGCGCGCATACCACCCTCGTC
ACAGACGCCGCGCTTGATACTCAAGATGCAGCTCCAAGCACCGCCACGGCCAGCAATGCCCTCGCACACTTGGCCATTCTGCATTTCACCAGCTACTGGT
CAAGCAAAGCAACCTACCAACCAACGCAAGTCGACATGGCTCCACTGCCATCTGCAGCGCAAGCAACAGCCACGCCCGACGTGGCACCCAACGCCAGTGC
CGCGCAGTGCTTCGACGACCTGGTCGACAAGGTCGAAAGTGGCTACGCGGCCATGCCCACAACCCCCAAGACTGCCACCGCCGCACCGGCCTTCGCCCCC
GTCAAGCCGCAGGGTCTGGCACGCTTCGCCGTGCAGAGCGTGCACATGCGCGAGTGCTTCGCCGAGTTCCTCGGCACCTTCGTCATGATCGTCTTCGGCA
TGGGCGTGAACAACCAAGTGACCAACTCGCAGGATGCCAACGGCACGTGGCTCAGCATCAACATGTGCTGGGGAATTGGCGTGCTCATCGGCGTGTACTG
CTCCGAGGGCGTCAGCGGCGCCAACCTCAACACGGCCGTGACGCTGGCCCACTGCGTGTACGGCCGCCTGCCGTGGTGGAAGGCGCCGGGCTACATGGTG
TCGCAGCTGCTGGGGGCCTTCTGCGGTGCCTTCGTCATCTACGTCATGCAGTACCAGAACCTGAACGTGATCGACCCGAACCGCGAGACGACGCAGAGCA
GCTTCGCCACGTACCCTAGCGACCAGATCTCCAACTACACGGCCTTCTACACGGAGTTCATCGGCACGGCCATGCTGGTGCTGAGCATCTACGCCATCAC
GGACAAGCGCAACAGGTCTGCGGGTCCCGTGGGCTCTCCGTTTGCGTTTGCTCTCATGATCATGGCGCTGGGCATGGCGTTCGGCATGAACACGGGATAC
GCTGTGAACCCTGCGCGCGACCTGGGTCCTCGCCTCTTCACGGCGGTGGCCGGCTGGGGCTCCAAGGTCTTCACGACGCGCAACTACTACTTCTGGATCC
CGCTTGTGGCCGACTCGCTGGGCGGCGTGTGCGGCGCGGGTCTGTACCGCGTGTTGGTGGAGATCCACCACCCGCAGTTGCAGTCGTCGCTGCTGTAAGC
GACATCTAGCCATCGTTTTGCAAGCCAGACGCTATCGTTTCGCAAGCGATGCGTCCAGGTGAGCGGACCGACCTGAGCGGCAGCGTAACCTTACGCGATC
GGTGTGTCAACTATAGAAGTGTACCATAGAAACCAACAAACGTATTATCTCCTTCGCTACTTTATTCTTTAGTCGCTTGATGACATAATACTGCCGTCGC
ATACAGTAATGAACGACAGCAGCAGGTGAAGCTCACTAGACTAGGTGGCGGTCGTCAACTCATCAGGAATGTTACTGTCGAGAGCATCATAAGTGCATTC
TAAACCCGTTCAGCCGGCGCACTCCCAAGCAGTGCTTGCATGCACTCATCTCAATATATTGCCTTGCTGACTCTTGCTTAAGTGTGCAGCAAGTACGGCT
GCTGCCATCGTGGTTGCGAAGGCACTTGCAAGTGCGGCGAGTCTAGGCCTGCATCCAGCAGCGCTTCGATCCTGCTGCATCTGGGTGGCGACTTTACACG
AAGCCTTCCAGCCTGTGCGCGTCACCAGGTTGCCATCGGACAGCTATAACACGAGCCAAAGCGTGCTTCTGTGCACAAAGACACCGGTTCACAACAGTGG
GATGCCGATCTCCATCGCACTTAGTAGAGCCACTTGGTTTTCATATGCTGCAGGTTGAAGTCGATTCTGAAGCACTGAGTGGGGCGCTTCAGAAACCAGT
AGTCGCGCCACGAGTGCCAAGCAGCAACGGATGCAAGACCCGTTCGACAGCGCTGCCATTGCCTGGGGTGAATCCTCGGCCGGCGCGATGTTGAGCGGGC
GTTAGTAGAGGTTAATACAGCTTTTTAATCTGCAGCACGTGGCGGCGGCCTAACGCGAGAGCGCACCTTGCATTCTTTGTGTGCACGCACCGGCTCAACC
GCCTGTACCTTGAAGTCCCGACCAACTGGAGGATGGATTTCACCAGAATACGCCGCCCCTATGGTCACTCTGCTGGATGCCGACTCAGCGGCAGCCATTC
AAGATCATTCGCCCTCGAGATCCGGTCGCTGCGCAATGCTAGTACGCTTGAACTTAGCCGCATCGCATCAACTCTGTAGATGGAATTGCTAATCGTGCCC
GGCATGCCACCGAAGCAGTTTAACGCTGTGCCAAGAGGCTGTTTCGGCGCCACGCAGCTTGGCGGCGACGACTGCGTAAG