Description :
From Genome Similarity Track
Location :
Scaffold_77:67281- 69245
Sequence
1964 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAAAACGCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGGT
CTACGATCTAGGCCCCGGATCCATAAGCTTGAATATTCGCTTAGGATACGGAACCATCCACGGAGGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACATATCATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTAGATCCGGCAATCTCGCAGATTTTG
CTGATCCCGCTACGCCTCAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGTGATTTCACCGTGAGCTTCAAGAAGATGCTCAAGTGAGGATTGAGCCA
GGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGATACAAGATCCGCGGATCGATGGAGTTTTGGAAGGAACTCTGTCGACGGAA
GAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAAGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCT
AACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCCTACTATACCTATACCTAAACCCAACCCCGCTAGTCGAAG
AATGAGAAAGAAGACGAAAAAGGGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGATTCGGAAGAAGACCAAGCTGGATCCAGGTCAGGCTGGTCAGAC
AAGGATCTCGGGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAA
GAGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTT
TGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCGTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGC
ACTAGGGATCCGGTGTCGTCGCCGAGGGTTAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGAC
GCATGACTTTAGGACCCTCCGGGGCGTCCATGCTGGAAGCGCGGGCGAGAATCCGAGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTAGG
CCCTACGCGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGTCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACG
GATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGG
CCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAATCCGTGGAGGGAGACAACTCACA
TGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGCCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGG
GTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGAATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCGTCA
TGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGC