Description :
From Genome Similarity Track
Location :
Scaffold_39:67235- 70743
Sequence
3508 bases(100 bases per row)
CGTTGTGGAGTATGACACCTTTTGTGAGCGACTTGCGGTCGGCCTCGTCGTCCGCGAAGTCGGCGTCGCTGTATGACGCCAGCTTCAGCGCGTCGCGACT
TGTTCGTGCCAGCGCCGTGTTGAGTTTGAGCGCTGCTGTGCCTTCGAGTTATTGTGCGATCATCTTGGCCAGCTTCCAGTCGTGCATACGTAGCGCATGC
TTCTGTCAGGTCGCCTTGTGTACGGCAAACGCCACATCAGGCCGAAAGCACTTTGCGACTCAGAGCATACTCCCGACAAGTGACTGGAACGCTTTGACAG
TCGGAACGCTGCTCGCACTCGTCGTCTCGAGCAGCAGGGCGTCATTGTCAAGCACTTCGTAACACTCTTCGCCGATCGGCGACTTCGTCGTGTTGACGTC
CGTCATGCCGTGTGCGTGCAACAGCTCTCGGATGGCTTCTTGGTCAGTGCGGTAGCCGCCGTCGTCGGCGAGCTCAACACGCATGCCAAGTAGATTGTAT
AAGCAGCCCAAATCTTTGATTTACAAGGTCTTAGAGCCCTCGAAGATCCTGTCCACTGCCGCAGCGCTTGTCCCTGTTGCAAGCAAGTCGTCGACGTAAA
CACCGACGACATCGAGCTCGTCTTCGTCCCGCCGAAATCAAGTACATGTCGGTGACGCACCGCACAAACCGGGAGTCCGTGAACCGCGCAGGAAGAAGCT
GGCTTCAGAGGCTTCCAACTTGCTTCAAGCCGTACATGAATTTGCGAAGATCGAGGACGACCTCGCCTGAGTTCGCGGCGCCGAGCTCGCGCAGTGTTTC
GCCTGACACGTCCATCCCACGTGGTACCAACAAGCGGATGTCGAGGTGTGCCTCCTTTTCCGCCTTTACGTATGCGTTCGGGATGTCGCTTCGTTTGGCT
GGGACGCCCCAGCTTGCCGCGAGCGCCAGCACGATATTGACTTTGCTGATGTCCATCACCGCTGCGAAGGTGAGGTTGGAGTCCATACCAGCACTTGTTC
GTTGCCGCACGCACCGATCCGCGCCTTGTATCGCTCCAGCTCTGCGTCGGTGCAGGTCTTGGTCTTGTAGACCCACTGTGACTGCAGCAGGTTCGATCCC
GCGCCTCTCTTTGCCACACGCCAGGTGCCGTTGTACTGGGGCGCTCTGATCTCTTCCTGCATCGCGACTTCCCACTCGGCCCGCTTCGAGCTGAGCATCT
CTTCAGCGTAGTTGCTCGGGTCCTTCCCGTAAGCGAGGTGGAACACGTCCGGAATCGATGATGGCCCCTCCATCTGCGCTGTTCCTCCTGCGCGCTTCGC
GGCACTCCACGTCCCGTGCGGCTACCGTTGCCACGGCTTCTTCTTTTCCTTCGGCCGTGCTGTCGCGCAGTTGTCCTAGCTGTCGCTGACTTTACCTCAG
CTTCTTGATGAGATTGTTCAGATGATGCGCGCGGGCTCGTCGTGATATCTCCGTGCCGCTCGCGACCAGATCGCTGAAGCCGCGCAGCAGTCTCTTGTTC
TGGTTTGCCGAGATCGTCGCGATGTTTCTGACATGGTACGTCGTGATTACGACATTGCTCTTCGGGAGATAAACCCGGTCCCCTTCGTCTTTTCGTTACG
CCCGACGATCTGATCTTCTTCAGATCGATGCACCAGCTCGTTCTTGCTCAATTCCCGTCGCTCGTCGCACGTCGATCCAAACACAACACTGTACCGCAAG
TCTGGCGCCACCTTGGTAATTACCTCGTACGGCGAGGCGCGCTTCGTTCGCGTTCGTCGGACTCATATTCAGGATGTACGTCGCGTACTCCACGGCGTCT
CCCCAGAAGTACGTAGGCATAATGTAGGCGAAATCATCGACCTCGCCATGTTGAATCACAGTCCTGTGCATGCGCTCTGCTTTTCCGTTACCCTCCTGAT
TACGCGCTTCGGTGATTTGACGCGCGACACCGGTCGTTTTTCAAAAGTGGTTCAAGTTTCGGTATTCTCATCCTCCATCAGACTACAACACGAGGATCTT
GAACCCGAAACGTCGCTCGAAAAGCGTCCAAAAATGTTCGAACTTTTTGGGCGCTTGGTCCTTGCTCTTTGCTAGAAACAATCGGCAGTAATTGCTTATG
TGGTCGACAAAATTTACCAAGTAGCGATCTCCAAGACGATCTTTGGACATCAGAGCCACCTTGAGATCGGAAAAAATCACGACCTGTTCGATCGGCGAGT
TGGCTCTTCTGTCTTTCTGGCTCTGGGCGTTTTTCGTCTGCTTGCTCTGCATACACGTGCCCCACCTGAGTCGACGGCGATGGTTGAGCTCGATCCCGTA
CTCGGGGTTGCGCACGATGCGTTCTATCGTGTCGTTCGAAAGGTGTCCAAAACACCGGTAAAATTGGATCAGCAATTCCACTTGCACGTCTCTCGACAGG
TCAATCGCATAATTGTCTTCGATCTCCGCCATGATCACGTCGGCATCTCCTCTCGCGCGTCGAGCTGTCTTCATGTCGACAAAGAGAACTTTGTTCTTCG
TCGTCACGTCGAAGGTGACTGCACCATCGCTTCTTCTCAAGAGCGATCGCGTGCCGTCATCGTACACAATCTCGAAGCCTTTCTGCTTCAGATTTCCAAA
CGACATGATGTTACAAGCAAGCTGCGACACCAAGTAGACGTCGGTGAGCGTCACCGTTTTCTCCATGCTTGAGACGACCACACAAAGCCGCACCCTTTCA
ACCTGTCTGAGCTCGAGCGCGTCGTCAATTTCCATCGCGATCTCGCGACTGCAGCGCTGAGTAGCAGCACCGCTTCGTTCACCAGGTGCCTGCTTGAACC
GCTGTCGAGGATCCAGGAGCTCCTGTCGCCGTCCTTGCCGTCGCCGAGCGCGTTGTCCGACTCCTTTGACTTAGCTTTGCTAAAAGCACGCGTCCCACGC
GCCCGCGGCGTGCGCTTCTTCAGAGCCAGAAACATGCCACTTTCTTCGCCGTCTTCACTCTTTGGGCACGCTACACTGTTGCAAACGCCACCGCCGCTGT
TTATCGTCAATCGACACTGCGACCTGATGTGGCAAGTCTTGCCGCACCCGTATCCTACGCGCGATTCCTTCTGCAACCGCAGATTGTTGACGTGCGCCGC
CACCACTTCCTGTCCAATTGACGTCGCGGTATACTTAATAGACTGCGCAAAGTGAGCCAGCTCCTCGGCGTGACGCAGCTGATCACTGCGGTTAGAACGT
ACTTCGCCTTCAGCACAAAACCGATCTCTTCTGACGCATGATTCACAATGTTGTCCAGCACGAGCGTTTCGGCGCCACCTCGCGCTTCGCCATGAGGTAC
AAAAATGTTCGGGCCATGTGCGATTTGCGTCATTCCGTTGCTCGAAGGGCTTCATTGCTTGCGCTGATGTGATAGACGTCTTAAACTTCACCAGCATCCG
GCCCATCACTTAGTCGAGCTTGGGCTGCTCGACCCCCCCCCCGTGTTGACTTGCTTGTGGTAATACCACTCGGCCGTACCACTCAGGTAGTGGTCGAGCT
GGTCCACC