Description :
From Genome Similarity Track
Location :
contig_122:67225- 70402
Transcript NameFunction/comments
g11430.t1hypothetical protein

Sequence
3177 bases(100 bases per row)
ATGACTGCCTATCTACTACAGGTGAACAATTGGCTCAATCGAATGTAAAGTTAGTCTGGAAAGGAAGCCTCGGCGTGGTGCGACCTGAACCAAAAGTAAT
TCATCCCGGGGGAGGCCATAGCCGCTGTTTCCTCTAGGGAGTCCCCTCCTACCGATACCCGCATACTTACTGACTGCAACTAAGACTGCGGCCGTGTATG
CCTCGAGAGTTCCGACGATGCAGTCTGGCGCTCGTTGGGGTAACGTATAGAGCGACACGCAGGGACGCTTTACCGGTGGTGGGGATTCTGGCAAGTATTT
CGGCGGTGAGTCTGTTATTCTAGTGGGTCCACTCGTTTGCTGCACACCAAACAGCGAGCAACGAACTGGGCCCGCGCCATATGAAGAATGTAACTGGTAG
TTGCGCATGCTCTGTTGGTAGGCACCAAGTTAAACAGCAGCGATTGGCCTCGACTGCAGGAGACGAGTTTCACGTTAGCTCGCCGGTAAATGCGCACTCG
ATTCCAAACACCAGCCACCACAGCACGGTCTGTGCTACAGACGAGTCTCTACGTCCACACTGATCCACCACTGCCAGTCAGCCCAAATCGAACTTTTCAG
CCAGCCAGCAAGTATGTATACGGCCGAACGAGTCAAAACTTTCGGTGTGCGCGGCAACGAACTCGCCAACTTGCTTGCTTGGATGATCTACGCGAAGCAA
AAACACGCGACGGCGAGTACGTACCCCCTGCCGGTCGGCCCATACAACGACCAAGTCAACCAGATAGAAACGGCCACAGCCGGGCCGCTCGACCGAAATT
AACGAGCAAGCGTAACCTTGAATAACCTGCGCTGTCACACCCGCCGATCAAGTCCAAGCCGACCGATTGAATGCGCGCATACCACCCTCGTCACAGACGC
CGCGCTTGATACTCAAGATGCAGCTCCAAGCACCGCCACGGCCAGCAATGCCCTCGCACACTTGGCCATTCTGCATTTCACCAGCTACTGGTCAAGCAAA
GCAACCTACCAACCAACGCAAGTCGACATGGCTCCACTGCCATCTGCAGCGCAAGCAACAGCCACGCCCGACGTGGCACCCAACGCCAGTGCCGCGCAGT
GCTTCGACGACCTGGTCGACAAGGTCGAAAGTGGCTACGCGGCCATGCCCACAACCCCCAAGACTGCCACCGCCGCACCGGCCTTCGCCCCCGTCAAGCC
GCAGGGTCTGGCACGCTTCGCCGTGCAGAGCGTGCACATGCGCGAGTGCTTCGCCGAGTTCCTCGGCACCTTCGTCATGATCGTCTTCGGCATGGGCGTG
AACAACCAAGTGACCAACTCGCAGGATGCCAACGGCACGTGGCTCAGCATCAACATGTGCTGGGGAATTGGCGTGCTCATCGGCGTGTACTGCTCCGAGG
GCGTCAGCGGCGCCAACCTCAACACGGCCGTGACCCTGGCCCACTGCGTGTACGGCCGCCTGCCGTGGTGGAAGGCGCCGGGCTACATGGTGTCGCAGCT
GCTGGGGGCCTTCTGCGGTGCCTTCGTCATCTACGTCATGCAGTACCAGAACCTGAACGTGATCGACCCGAACCGCGAGACGACGCAGAGCAGCTTCGCC
ACGTACCCTAGCGACCAGATCTCCAACTACACGGCCTTCTACACGGAGTTCATCGGCACGGCCATGCTGGTGCTGAGCATCTACGCCATCACGGACAAGC
GCAACAGGTCTGCGGGTCCCGTGGGCTCTCCGTTTGCGTTTGCTCTCATGATCATGGCGCTGGGCATGGCGTTCGGCATGAACACGGGATACGCTGTGAA
CCCTGCGCGCGACCTGGGTCCCGCCTCTTCACGGCGGTGGCCGGCTGGGGCTCCAAGGTCTTCACGACGCGCAACTACTACTTCTGGATCCCGCTTGTGG
CCGACTCGCTGGGCGGCGTGTGCGGCGCGGGTCTGTACCGCGTGTTGGTGGAGATCCACCACCCGCAGTTGCAGTCGCCGCTGCTGTAAGCGACGTCTAG
CCATCGTTTTGCAAGCCAGACGCTATCGTTTCGCAAGCGATGCGTCCAGGTGAGCGGACCGACCTGAGCGGCAGCGTAACCTTACGCGATCGGTGTGTCA
ACTATAGAAGTGTACCATAGAAACCAACAAACGTATTATCTCCTTCGCTACTTTATTCTTTAGTCGCTTGATGACATAATACTGCCGTCGCATACAGTAA
TGAACGACAGCAGCAGGTGAAGCTCACTAGACTAGGTGGCGGTCGTCAACTCATCAGGAATGTTACGTCGAGAGCATCATAAGTGCATTCTAAACCCGTT
CAGCCGGCGCACTCCCAAGCAGTGCTTGCATGCACTCATCTCAATATATTGCCTTGCTGACTCTTGCTTAAGTGTGCAGCAAGTACGGCTGCTGCCATCG
TGGTTGCGAAGGCACTTGCAAGTGCGGCGAGTCTAGGCCTGCATCCAGCAGCGCTTCGATCCTGCTGCATCTGGGTGGCGACTTTACACGAAGCCTTCCA
GCCTGTGCGCGTCACCAGGTTGCCATCGGACAGCTATAACACGAGCCAAAGCGTGCTTCTGTGCACAAAGACACCGGTTCACAACAGTGGGATGCCGATC
TCCATCGCACTTAGTAGAGCCACTTGGTTTTCATATGCTGCAGGTTGAAGTCGATTCTGAAGCACTGAGTGGGGCGCTTCAGAAACCAGTAGTCGCGCCA
CGAGTGCCAAGCAGCAACGGATGCAAGACCCGTTCGACAGCGCTGCCATTGCCTGGGGTGAATCCTCGGCCGGCGCGATGTTGAGCGGGCGTTAGTAGAG
GTTAATACAGCTTTTTAATCTGCAGCACGTGGCGGCGGCCTAACGCGAGAGCGCACCTTGCATTCCTTGTGTGCACGCACCGGCTCAACCGCCTGTACCT
TGAAGTCCCGACCAACTGGAGGATGGATTTCACCAGAATACGCCGCCCCTATGGTCACTCTGCTGGATGCCGACTCACCGGCAGCCATTCAAGATCATTC
GCCCTCGAGATCCGGTCGCTGCGCAATGCTAGTACGCTTGAACTTAGCCGCATCGCATCAACTCTGTAGATGGAATTGCTAATCGTGCCCGGCATGCCAC
CGAAGCAGTTTAACGCTGTGCCAAGAGGCTGTTTCGGCGCCACGCAGCTTGGCGGCGACGACTGCGTAAGTACGCGA