Description :
From Genome Similarity Track
Location :
Scaffold_17:672104- 678600
Sequence
6496 bases(100 bases per row)
CGTCTAAATTCGGTGGTAGCAGCATCGTACCAATTATGGTGGGGTCGCCTTCGCTACGCTGGGCAGCTACTCGTACTTAGTGTAATTCGTACTTAGTGAA
TAAGCGTGACGATTTCTGTGACCGACGGACGGCGTCGTTCTCATTGATTCTTAGGACTGGCCGAGCGCCGCCGCTACGCGGCGGAAGGTTTTGTGGTTAA
TCGTAGTAGTTGGGGCCGCCCACCTCCACTTCGCTCCGGTGGGCTTTTATTTCGTTGTGTGTAGGTAAAAAAAATGGTTGAAAGTACTATCAGTAGAGTG
ACGTTTCTGGTATCAGCTTAATAAATATTCCACCGTTAGACCTACATCAGGGTGTCTATAAGTAGTTGCATGTCGCAATGTTAAACATTCTCTATTGTAC
GGTCCTGTGCTCCCGTCGCAACTATTTAACCCTAATTACAAAGTACCGCACAGTACATATCTCACAATCTGCGTTTACTGTGAGTTTAATAGAAATAAAC
ATGAGCAATATACCATGGTAGGGTAGATCGATCTGGTGTTGGTATCTTATGTGTGCTCACATAAGTCTATGTTTTACGTGTTGTTTATTCAGTTTATCAT
TCCACCGTAGCTCACTGTTTTTAGTTCGTAGGCTATAATACCTTCATTCTACATTGGACTATAAGCCCCAGCAACAATCAAAGTATGGGCTTCGCTCTTC
CTGTACTTAGCATTACATTAAGTGCTTGTGATCTTATATAAATACCGAGTATACATCATCGTTTTAGTATTTCGTATGTTCTGCCAAACGTAGCTGTGGG
CTGCGCTAACTACTGCGTGGTCTACTTCAAAACTCATTGTTTTAGACGTGGTATTATTCTACTACGCGGCGAACATTACCATTTTAGTGTACCACCTGCA
TTACAGTAGGTAAGATATAGAGAGTTCGCACTCGTAACTATATAGTTGTAAAGTCACGTTTGCCCTTTGTTAATTCGGATTCCTGCGTGTATATCCGCCC
CATAACACGGTTAGAAAAGGAATCCCAGCGTAAACTATAATAAAAGGCTTCCACTCAGTGAATATTATCTACTACCCCACTAACCCATTCTCCTAACGCT
ACGCATTGCACCTTAAAGATATACGAAACGCGTTTAAGCAAGTGTAGCTAAATACCCCCCCCCCCCAGATAAACGCAGAGCGCCGCTGTAGCTATAATGT
ATCCATCCCTAAAGTATTACAGTAAAAATATGATGCTCATGTTAATAATAATCTTGTGCACGCCTTCCGCTACGTTTACTCGCACTGCAATCACTTACAA
CGTTGATGCTATCGCTTACTACGTGCTCCTATAGCTTTCTACGTGCTGCTATCACGTTCATATCGCTTTCTACGTGCTCCTATAGCTTTCTACGTGCTGC
TATCACGTTCATATCGCTTACTACGTACTGCTAGCGCGTAACTATGCCGTTCTATCGCTGACTACGTGCTGCTATAACTATCTATACGCTTCTATGGCTT
ACTATGTGTTTGTATTGAGCCAACATTGCTATTGTACTACAGTAAGTAGCATGGTAGGTTTACCTATCGCTACAGTAGCTAAGGGATTGAAAGTAAGAAG
TTCTTACCCCGTAACTATGCGTTTGCGCTATGCTAATTCCGTTTCCTGCATGTGTATCGGTCCAATAACATGGTTAGAGAAGGAATTTCTGCTATAATAA
AAAGCTCCAGGTCAGTGAATGTCAGAATATCTACTACCCCAATAGCGCATTAACCTACCGCTACATACTGTGCCTTAAAAAAAGATACGAAACACGTTCA
ACCAAGTGCAGCTAAATATTCCCCCAAGATGAACACAGAGCGCCGCTGTAGCTATAATACTTAAGTATGAACATTCCTAAATAATTACAGTAAAAATATG
CTATGCGTGTCAGTGGACGCCTTCCACTATATGTACGCGCACTGCTGTCGCTTACTGTGCGCTTCTATCCTTTACTATGCGCTTCTATCGGTTACTCTCC
ACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCACTACCATACCAATTATCGTAGCATGTGTTTATATG
AAGCAAACCTCGCTACAGCGCTATTATACGGTGCCCGACCCCAGCGATAGCTGCTACTACTCGGTGGGTCCATTTTAATTAATAGCTGGTGTTCCAAAAC
GTATTAGGCCAAGCGTCGCGCCGGGGTGACGTAATCGCCCCCGTTCCACACGTCTCGTCGGCTCGCTGCACTACTCGCCGTGTTATTAGAACATAATTGT
AGGGTGGGCCCTGCGGTCCGCTATAACACACGCGGGTGCCGCCTTCGCTGCGCTCGGCAGCTTGTAATGGGACCGCCTTTGGCGTCCACGGCAGTACGAT
TATGTGGACCACCTTTAAAGTGGACAGGGTGTGACGGACGGAATTACACACACACTGGACGGTCTCTCTATTAGTTGTTGTGGGCTAGCCGAGCGCCGCC
GCTACGCGGCGGTAGTTTTGTGGTTAGCTGGCGCTTCGCTCACTATACTCGCTCCGCTATTGGAACAGGCTGCCTACGCTTCGCTACAGCAGTAGTGGAC
CCGTTCCGCTCGCCTCGTCGGCTTGCTGCACTACTCTCAATGTCAGGTTAGTACTACAGAGGCCGGGGCGGGTCCTGCGGCCCCGCAATATCGTATAGTG
GGGTCGCCTTCGCTTCGCTCGGCAGCAATTCGTATTTAGAGGGATTCGTACTTAGCGAATAAGCGTGATCTACGGTCGGATAACGACTTTCTGATTGATT
GTTAGGATTCCGAACTGACTGCTAAACGCGTGGCTCTCTGCTAGGCCACGGATCTACGATACTGCGAGTTCGCTGTTCGTAAGAACTGTCGTTACTACCT
GTTTGATGCCAGATACCGGTATCGCCAGAATTATTTACTTGGTTTTGTATTGAAATCAGATATCTTAATTTTTGTATGCATTCAAATGACTTACTGTTGT
ATCGGGTCGATTTATCTAAGCATTTGTATGCGGATTAACTCGTGTTGGACACATAACTCAGGCGAGTCCCCTGAGGGGACAACGAGTAAAGGTATAGGGG
ACAAAGAGTAAAGGTATAGGCCAGAAAGCCTTTAGATGGAGGTATAGGCCATGATTTTCCTGATCCGAGCTGGGCCGGCTCGCTTAATGCCATTTTATAA
TTTGCTGAACAGGAGAACGGGCATGAACTGGATGCTCGCATAATGACAAGAAGGAGCAGCAACATGCGCTTGAGTCTTCAGGTACTCCCATGAATAATGG
CGAAACTTGGCAGTTGTACTGTAGAATGCGATGCGTTGGAAGTGCTGGTGCTGTAGGGGTGATTTTTATGCAGCCAGTAGCTAGATAAGGCCCAATCGTG
CCACAACTACGTGCAGCACGAGTGTGTATAATTGCTGTGGTATCGACAACTCCACTAATAGCGCCTGATCTGAACCCCTTGTCAGGGCATGATCGAGGCC
TTCGCTGCTGGAAAATGTCAAGACTCTGCATCAGGATCTCAAGGACGCCCCGAAAGACAAAGTCACGCTGGAAGGGTCTACCAGCACGTGCGTAAAGGCT
CCCGACTGCAAGATAATCTACTCGCTGCGACCCTCGATCCTGTGCAGGCGCGCCGTGTGACCGAACTCAAAGAACGCAAGACTATCTCGATATGTTCAGT
GTTAATGTAAACTTAAGCTCAGAGGAGATATTTAATTATTGCGACTGGTGCGCCGCAAGTGAGGCGCGCCCAAGTCGCTTGTGATTTTTTATTTGATACA
AATAAAGGAATCTAGTTGCCCCACATGGTTCTTGGTGTGATGATCATTTAACTACATCTCCGTTACAACAATTGAATGCGCATTGAACAGCTCGATATAA
CGTCGAGTCCACTTGCGTCATCTGGTAAGCTTACTGCGAGGAAACCATGCTCACACAAACGTTTTAATCCAAAGTGTGCGGCCAGTGACTCTGAAAAAGT
CAGCATTTCGGATTAGGACCGGTTGCGAAAGCTCTCTATAAGATATTTTATATAATAACGCAAGACTGATTTATGTCTACGCGCCAAAAAATACTAACCG
AGAGGTGGACAAGTGTTGCGTGGGAACATGTCTGCACCTGGTCGAGTTAAAGTTTCCGTCATGCATTGTTATCACTAGCATTATTACCAAGTGAAGGGCC
AACAAACAACCTATCCGGATAGGTGGGATATGTATTTGAGGGTAGCCTTCGATTTGGGTCAACCCCAGGTCAAATCAACGCTGGCCAACGCACCGATTCT
ACAAATCTCATGTTAGTGAAGCTCCAGCTGTAGAGTACTAATGCATCTGGTTCATCGTGGTGCAGTGATTGATTGACATGTCAAGCAAGTCGACAGTGAT
GTCTTTTGACTGCGTTCTTGTGGTAGCTGCGCCATTCCTTAACTTGCTCCAGCGCGAGCAACGTGCCATTCGTACGCATATCTACATCCGGTTTCCCTCA
CGCCCAGCCTCTAACTCGACTGAGGCGTGTTGCCGATAGACAATGGGGCTGCAGCGTGGGGGAGGTATGGCTTGGCTTGATGTACTACGCCGACACTACT
CGAAGGATTGCAGGTACATACATGTAATTATCCTGGAAGGACAGCTAGAAGAGCTGTATGGACAGCCTCATACAGATTAATTCGTCGAAAAAAAGTTGCT
TGTACCTCAGGCAACATTTAAACAACATTTCGTCACACCATACTCACACAATCGTACACCATTCTTACACAAATATAGCCATATTGACATCCCGACCGTA
CTACACAAAGCTACCGTAGCATCTTAGTCCTAGGCGTCGTTCACTCCTAAGAGCATCTCCAGCGGTGGGTCATATCCTAAGACGTAACAGGGTCTTTGAG
ACCGCGATTTTACAGTTGAGACCCGCGCAGACCGACTTACTTCCGGCGATGAGTTCTAAAGCGAGTCCTATAAGTCCATCCCGCATGTCAAAATTGCCTT
CAGTCTTGGTGCAATCTTTTAAATGCGGCGACTCTTCAGTTTTGTATGGGTGGCATTAAGATTGTGGTCTTTTTTTAAGACTCGAAAGCCAATCTATAGG
TCCCGGTGAAGTTAAAACCTGCAATAGGACCTTCTGGTGGAAGCCTAACGTCTCGGCCAAGTCTTAACAGCGTTACTTTTAGGATAAAACCGTGTTTGAG
ACCAACCGCTGGAGATGCTCTACGCGTCAGTTGTAAATTGACCAGTAGGACACTGCCATTTTTAACATATGGCTACATTACACATGACTTTATTTTTAGG
CTCTATTCCGTTTAAAACAAGGCTTTTCCAGCACACTCGAAGGAAGCCTGCCGCCAAGGAACTTCCGCGGCGGAGCATCAAGGGAAATGACAAGAAAGTG
AAGAAAAGCAAGACGTACCTACGCGTGCCGGTAGACTACGCACAGAAGATGAAGGTTCTCGGTGGTCGGCTCAAAGTCTCTATTGGATGTTATGGTACTG
GGTGCTCAATGACGTTAGATAGTTGGGGACGCTCCCATCACACGTGCGTAGCTTCTTGGAGCTGCCGCTGATGGAGAGCACCGCTTGGTACTCGACCTTG
AGACCGTGGCCCGGCGTCTCCTTGTTCATGCTGGCCCACGTGTTCTCGCTGCTATGGGTGCGGCCGGGCACGCCGCTGCTCTCAAATAAGTGCGCGATGC
TCACAGTCTCTCCAAACAGGTGCTAACGCGGGTCCTTGCTGCCCACGACGCCAGCGAGCACGGGGCCCGAGTGCGCTTGTGATTTGCAACAAGTGCTTGT
GCAGTGGCGCCTAGGACTAAGATGCTACGGTAATTGACATTGAAATGAGGCCAGCGTTAGCGACAAGAGAATACAGGATAACCAATCAGCCTACAACTAC
ACTGTATTCCATATATGTAGTTCCTAGTTACTGACGGATAACTGAGAACGTCTTACGTCCACGCAGCTAAGCTCTTGGCCGACAAATTAAACCTGTCCGC
CTGGATCTCGGGCAGCCTCGCTGCCATTATATCATCGGCTTCATATAAAAATAGTGGTCGGCGCTGCAAACGCTTACTGCCTTAGTTCTTGGTCTACAAA
CTATAAAATCCGTCCGGTAGGCAGCTTCGCTGGCAGTAGATAGTTGGCTCCAAATAAAAAAGAAATTTCCGGAATATGACTCAAAATGAAATTTCGCGCA
AAAGGTGATACAAGGCTTTGTGCCAAGTGCATTTGGCCACCGATAGCGGCCAGCATCTGACTGCCATGCACGTCGCTGAATGCACCAATTGTGTCAGTAT
AGCACTGGGTAAACGCGAAGGCGGTGCCGGTGTAGGCATCGCCCTCTGCCTAATAGTTGTTCTGGTGGAGTATGGTCGCCTTCTGTGTCGCGATAC