Description :
From Genome Similarity Track
Location :
Scaffold_260:6720- 8566
Sequence
1846 bases(100 bases per row)
TAACCAGTGGAGCTGCAGTTGCCGTCATTAAAGTTGTCGTTAAATGGGCATCTAGTTTGTCGTTATAGTTCACTTGATTTCTGCCTGATCATCAGGATTC
CGTTACGCACGGGGTACTATAATCTTACTTTGCGTTATCCGCAAGATTCATTGTCGCAGTCATCACGTTGACTGCGACCAATACCGGTAGTACTGCTGAT
AGGCTATCTATCAGTGATAGCTGGGGCGAAAAGTATATTTTGTGGTACCATTATTATAATAACGTCGTAAGACTGTGTCAACGGAGCAGCAGGCGACGCC
GCTCATTCGAAAGTTTGTTGTGAAATCTATTTTGTCAGCGCTGTGTTGCTTGCTGTGGACGGAACAGCCGTGAAGGTAGGAGCTTGTTGTCTCTTGAGGA
GAGAGAATGGTGTTGAACATGGTACTTTGTTTGTTGTTTTACAGGCCCTACCTACCCTGGTACAAAGCTTTCAAAAACTAGACTCGTTCGGGAGACAAGT
CGCTCCAAGACCTTCATCAAGACGCACAAGAATAATGACGATAACCTGCTGCGTGCGTGAGGTTTTACTTGCAGTATTGATCAAACCACAGTCGATCTAT
ATTTCTTTTCATACCTCCACTTGCAAACCAAGGTTAGATGCCGTAGCTGTAGACCCAACGTAGCAAAAAATATCGCTATTCCTAGAAGCAGTTCTCGCAC
GTTTACCGGTACTGTTAATTGAGAAGGTGGTAGCTGTGCTGCATGTTAGAATTACCGAATTCCTGAGAACGCTTTTTTGTTTTTGTGTCTTTCTTGTCAG
CTAACTAAACAGGTCAAACAATAACCCTTCGATGGAGATATAAGATACGTAAGTATCGGGCGGTGCAGGAGGAATGCAGTACTCGTACTGGCGTTACGTG
CCCGCTGATTATCTGCTCATTTGCCATAGTCAACTACCAAACTTCTATTGTGTTTTGTTAGCCCTACCATTTTTCATGTGCCAGCAGTCCCCGTACTTGA
ACGTATAGCTCTGACACTCTGGCAATGTGACCCGCTAGATACCTTACTCTATTCGCGGCGTGATTTATGGTGAAGTACTAATGCGAACTACCAAGCTATC
CCAGCCTACGCAGAGCTCTAGTTTATTATTTTTTGCCATTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGTCA
GTATGCAGTGACCTCACTTGCTATGGGCCAGGGCGCAGTGACTCTCACAAAGAAATGGGTCAACTCGCAGTTTACCCGTAAACAGCAAATGTGAGTCAGC
CCACGCCTCGAACAAACCAAACCAAACCAAACCAAACCAAACCAAATGGTTCGCAGAATGAGCAAAACCAAGTAACCGTTTGAACCAAGGTTCGTTGCGG
CTACTTGGTTCTACGGTGTCGGGCGCCATTTTCAAACTAAAACGTACGGTTCGTCCGCGCCACGATGGTTTAATTGGTTTCAAGGAACCAGTATACCGAG
AGTTTCAGGTTCGAAATCGGTATTCTTTTATGAAACGTTCGAACCAAACCATTTGGTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGG
TTTGGTTTGTTCGAGCCTCGAATGGAGGCGTGGGTCGGCCCTTTTGGGTTCGCGTGTTGCCCTTTTTGGGGCATTACCTACTGTCATCTGTTTACCCAAA
TGGAGGGCCTCATCTCATGCTAACAATGTTATGTGTTGGCCTAACATGTCCTAGACGACAGCAAATCTTTTGACTTCTTCCTGGATGTTGCAAGAAGTAA
TCGAGGATTAGAGACGCCTTAGAGACGCCTTCGGCACCCCCGTGAT