Description :
From Genome Similarity Track
Location :
Scaffold_54:67195- 80061
Transcript NameFunction/comments
Physo_137434OSJNBa0080E14.12
Physo_137435hypothetical protein

Sequence
12866 bases(100 bases per row)
ACCATTTTTTATATGGAGCCAATGATCTACATGTAATGCCAGCGAGGTTGTCCGAGATCCAGGCGGACAGGTTTAATTTGTAGGCCAAGAGCTCAGCTGC
GTGGACGTAAGACATCCTCAGTTATCCGTCAGTAACTAGGAACTATGCAATACAGTGTTGTTGTAGGCTGATTGGTCATCCTGCATTCTCTTGTCGCTAA
CGTTGCCCTGATTTCATTGTCAATTGGCTTTGTGTGGTACCGGTCGGGATGTCAATATGGCTATATTTGTGTAGGTATGGTGTCGCGAGATGTTGTTTAA
ATGTTGCCTGAGGTACAAGCAACCTTTTTTCGACGAATTAATCTGTGTGAGGATGTCCATACAGCTCTTCTAGCTGTCCTCCCAGGATAAATACTTTTCA
ATACTAAATGTATCAGATTAGAGAGGTAACAGTACCGTAGGTATCATTCGCATTGTTAAGGACATAATAGGATAGAGCAGATGTAGGGTGGTTGTGGAAG
CTTCTAGAAAGGAGGTTTCATCCACTCGAACTGCGGGGGCGGTCACTTTTGGCTTAGACCCGCCACCCCCCCAAGTCTGGCTTCCTCTTCATTTTGAAAT
ACTGGTAGCACTTGTTGGTCCCAGCAACCTGACAACGAGGAGATCATGCCCACCATCGCCCAACTACGCGCCGAGATCGATCGGCTGAACCAAGCGATGG
CGGACCGCACGCGAGTGCCGAGCAACCTGCCGAAGTTCACCGGCAAGCGAGGGGAGGATGTCCGCGAATGGCTGTTCCAGATCGAGAACGCCTGTCGAAT
CAACAACATCCCGATCGAAGACGCAAGCACCCGACTACCAGGAATCGCGGGGTCGGCGATGGAGAAGCCTGCCTCCGGTTGGTTCCTGCACTGGTCGTCG
ACGACATGAAGCGAGGAGCACACGTGGGGGATTTTCCGTGAGCATGTGCTCCAACACTTCGAGGCATCGAACTACCAGGCTGTCCTGCGCGAGAAGCTTC
AGCGACTCAAGCAGGTAGCAGACATTGAGACGTACAACGGTGAGTACTCAGCTCTCATCTTCAGAGTGGAGGGCATGAGCGTACTCGACCAAGTGCTGTA
CTACGCGAACGGTCTCAAGCCTCGCACGCGCAGATACGTCAAGCTCGAGAACCCCCAGACCCTGAGCGACGCTATGGACTTGGCTGTCAAGTACGAGGTG
ACTCACTTCGTCGAAGAAGCTCGCGACCGTCAACCCAAGCGCGACAAGAAGTTCTCGTCGGCTGATCAACCTCACGCCCAAGGTAAACCCTTCAAGGGGA
AGCCGTTCCGCGGGAAAGGCCGCTTCAAGCCGAGAGCTGAGCCCAAACGCGCCGAGGGTCGTACCTGCTTTCACTGCAAGAAGCCTGGTCACATCAAGAC
CAACTGCTTTCTCAGGAAGAAAGACCAGGAGAAACAGGGAAACGGGCAACCACGTCAGCGAAGGAGGGTCCTGTCGTGGCTAAGAGCGTAACCAAAACAC
CAAAGATTGAGAATATCAGCTTGAACGTTCTGTGCGAAAACCCCCTGGTCTACAAGTCACGTCCACTGTTCTCCGTAACAGGTGAAATCAGTGTTGGTGA
CAGGTGTCTCGCGACACGAAGCATGTTGTTGGACTGTGGAGCCACCACGATCTACGTATCCAAGCGTTGGGTCGAGGAGCACCAGCTTCAGACAACCAAG
TTCAGCGACAAGAACATTCGTGTCAAGCTGGGAGACAACCAAATTGTCGAGGCGGAGCTTGAAGTTCTGCCGATAGAGATTCTGGTCTCGAGGCTGGACG
ACGCCTACAAGTGTGTGGCAGTCGTCTACCCGATTCCAGACGAATTCGATTGCATTCTTGGAATACCATTCTTCGAAGACATGCAACCACGTATTGACTG
GAGAGGTCGATGAATCGAAGGAACGAGAACGAGGACTCTGCGCTGGGAGCGGACAAGTGACACCTGTGGACCGATCGAGGAAGGCGGACCGGTGATTGCC
TCCGGGCTTCGGAGAACTGTCGAGGCGAAAGGCCTTTCGGCGAAAAGACCCGATTCCTGTCGAGGCGCCGCACTGGAAACGGATGTGAAGTCCACGTGCG
AAGCTGTTCGCGACGCAGTGCAGAAGGAGACCCCGACCGTTGTCAGCAGACGACGAGGAGATGACCCGCAAGCTGGCGAGTGTTCAGCTGGAGAAGACGA
CGTTGCGACGTCAGAACGCGAGAGTACTGCACGAGAAGCCGACGAAAGAAGCAGTACCAGGGGTGGAGACAACGTCGTGGAGAAGATGTTCACGATGGGT
GTTGTCGACGATAGTGGTGTGCAGACCAAGTACATCACCCGCAAGAAACTGCGGAAGTTCCTGAGAATTAAGACCAAGACGAGCGACGAGCCTGACTTCA
TGTTGGTGCTCTCGAACGAGACGATCAAGCAAGCTGCACGCTCACTGCAACGACGAGACCAACCCGACAATGTTGGTAGTGCGAAAGCACATCGCTATCT
GGAAACGGACTGGGACAGTTTCCGTGAAAATCCAGCCTTCGACCTCCTAACGGAGTACAAGGACAACGTGTTCCGTCCTGAGCTACCCGAAGGTTTACCA
GAGAAGCGCGACATTGAGCACCGGATTGATGTGAAGGATCCAAATCTGGCGATGTACCGACAACAGTGGCGACAGTCTCCTGAGCAGCAGCGTGAGATCG
TGCGTTGGGTCGAAGACATGGTGAAGAAGAAGCTCATCCGACCAAGCATCAGTACTCACGCAGCACCGACATTCTGTGTCCGGAAACCAGTCGGATGGAG
AATCGTTCACGACTACCGGTATCTCAATTCAAACACTGTGCGCCAGAGCATCCCGATGACGAGGAAGGAAGACATCTTGGACGCCATGTCTGGAGCGTAC
TGGTTCTCCACTATGGATCTGATGTCCGCGTATTACCAAGTGCGTATGCGGGAGGAAGACATCAAGTTCACAGCTTTCCAGGCGCCAAACGGACTGTGGG
AGTATCTTGTACTTCCGATGGGAGTCTGCAACGCGCCAGCAACAATGCACCGGTTGACTTCGAAGCTGTTCCGAGACTTGAAGAACACGAAGTCGTTCTA
CGATGACATCTACATCTTCATCAAGTCACCGAAGATCGAAAACCATTTGGAGGCGCTGCACGGACGTTGGATATCTTGCGCGACAACAAGCTGTACGTCA
AACTGTCCAAGTGTGTCTTCTGCACCGACGAGATTCCATGCCTTGGTGATTTCGTGGGACGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCTTCATACGCATCCCACATCTCCATTGCGACCAGATCCGGCTGTCCGAGATAGTACAAGGCCGAGCGGAAAGCATCCATAAAACAA
GTACCAGCCTCCGACGCGGAATCACGCTCCGAGTACCAATAACAGAAGGTGCGCTTGTCTCCCGATTCCTTCCAAGCGTCCACCATCCTCATCATGTAGC
GCGTCGACGGTTTGTCGAGCTGCTCCATCCAGACCCAGCTTAGCTGTAGCGGATTGCCTTCCCATTCCACCAAGTTTCAACGGTGCGGAGCCTTGCCCCT
GACATCCAAGGCACGGACGATGTCAACCTCAGGGTTGTAATCCCAAGGCTTCTTCGGGTCGTAGTGGTTCTTGCGGTTGTTCGACGGGTGCTTTTTGGGC
GCCGGAGGAAGCGGCATCGGATACCAAATCGAAGTCTCGTCACCGCGACGCATGCGCGAGCGGTCAACCTGAGGCAGACCTTCATTATCGTCACTATCAT
CGAAAAGCCCGAATTCATCTTCAGGCGAGGCCTCAAACGACGCCCCAAGCGCAGGGTCAGCACCTATCGCCTCCTCGACGGACAACCCTTCCACATCGAG
CATGAAGATCAACTCCTGGAGGCGCGTAGGTGGAGAAAGACCACCAGCCGAAGCAACAACCTCAAGCGGCGCTGGCGACGCAGGCGGTGCAGGTGACGCA
GGAGGCCCAGGCGACGCTGGGGACGCCGAGCCCGAATCTAGAGAACCAAGACCGAGAGAGCGACTGGTGAGCTCTAATTCTTCCCACACACACGCACCAT
CTCTTCGTCAAGACCGGAGTCAGCATTGCTGTCTTCACCAGCAGCGGCCACAACATCGACAATCTGCGCGAGCGCGGCGGCGCATTCAGCGTCTGCCGGC
GCCAGGCGGAAGCATGGACGGACCATCGAGATTTGCGGTCGCCAGAGGCGACGCAGACGGCGGAGGCTCAACATCATGATCAGCCGTCGCTGGAGGCGAG
GCAGAACGCGCGGAAGCAGGAGACTGCATTCCGGCAGCAGTAGAAATCGCTAGCGACACAACCATCAGCCCAAGGAACCAATCCAAGCCTCCAACAACCC
GGCCGAGGCGAAGGAGAAGCGAGGTCGGACTAATTCCTCAGGCGACAGCCGGAAGCGTCGCGGTTTTCTGTCTTCTTCGGGAATGACATGTCGGAAGGGC
GCGCAGCCAGAGAAGGGGTGAGTGTATCTAATTGGTAGAAAGGTAAGCCAATAGGAGGTCAGTGTAGGTACGACTCACCGTAGGTATAATGAAACCAAGT
TAAAATAGATATGCAGATGTAGGGCGGCTGTGGAGGCTTCGCGAAGCTTCCATCCGCCTGAACTGCGGGGGCGGCACTCTTAGTTTCGCACGCCCTCCCC
CAAGACAGCACTTCTTCCTGTTAAACATTCCCGTTTTAGCTTACTGGCAACACGAGAAATGAGCGACACGTCCTACGTGTAGAAGTATCCGGCTAGCCCA
GCGTTGGCACTTCTTCCTCCCTGGAGAAGACGAAGAGCGGCGCAACCGGGCTGAAAATCTCCTTGATGATGATGAGGTATATTGGATTACTTAAAAGAAT
CCTAACAACCGAGCCGATCAAAAGACCAGCAACTCGGCACGATCTAGATCTGCTGACGTCTGCCACCCTGGCTTTGGTCTGCCATGCTCGTGTCCAGTTG
CGCCTGCGCGAGCATGTAGATGTTTTGCCGTATAGCCTGCTCCAGTGAGGGGATGCTTTTCGTAAGTGGGTCGACCCCGGGATTGTCGTCGGAGTCGAGT
GGCGACCCAGTCGTAGCAAGTAGGACACAACCTGTGTTGGCGTTTGGGTGAATGTGATGCCATGCATCAACCCGTATCCGATCTGCTAGCCGTCTGCACT
TGAGATACAAACGCTTCAGGTTCTCCGTCTTGGGTAGGCGTCTGTCGCGAAGGTAGCGGACCACCACTGATGAGTCTCCTGCCACTTGAATCTCGCGGAG
ATTTAACTCATATGCTCGATTGAGTAGTTGTAGTAGCGAGTGTAGAGCAGCCGTGCTCGCTGTGCAGTTATCTGGTAGTTGCTCTCTGCTGCCTCCACCT
GCTAGTATGCCGTTGTTGTCTGGCGTGTTCGTGTCCACCAGCACGTAACCAAATCCCCCATGCCGCTTGGGGTGCGATGACCTGCCATGAAAGAATCCCA
CGGGCTGCCGCACTGTAGCTGTTGGGCTGCAAGGGGCAAGTTGTATTGTTGTCCGCAGCGCGGCTTGCATCCGTTGTGCCACCTTCCACTCCGGATATCG
CGTCGAGGGCTGAAAATCTCCTCGCTCCAGACGCGCTCACATCCGTCAGGGCGGCGGCCTCGTAGAAATTATTGTCCAGGTCACTGCACTTCCCACCGAT
CAGAGCCATTGCCCTCTTGCCACTGCGTCTTCCACCAAGTCGGCAACTTTCTCGGGTCCAATGAGCGCAATCTTGAGATTCTTCCCAGTTCGAACGTGGA
CATGTCATAGACGGACGAGTGAGCGAAGATGCGGTTGCGACGCGCTGTTCCCTATATGTAGTAGGCAGGGAACAAAGCGTTGCAAGTACCACGTGCTATC
GTCCTATATAGGCTGCTTGCAGTACTAAGTTGCATTAATAAGTAACTCAGGAGGGCAAAACTCATGGGATGATATTATCTTGCTCACCTAAAAGTTTCCT
GTTCTAGCAGCAGACATGTCTTTATTCCAAACGATTATCGTCGGTAGGCGCCGTCTAGACTAGTCTCTACCTAGCAAGCTTCATAGCTGCGTCGAGAGCT
TCATCGGGCTTGTTGCTGGCAAACAAACCTCGCACTGTCTTCAGAAGTTCCTCTCCACCCCGCCTTGCAGTATAGTAGATCGTGTACTCTTCCAGCGCTC
TGTAAAATATGTGATCCTTCTCTAAGGCGAAAATTGTTGTTCCCCATGGCAACGCCAACTGTTTCCCGACATATCTGGGAGTGAACTTTTTGTCTAGCCA
TTTCTTGAACAGGAAAGTCGGCAAGTTATCTCCAAGGGTTGCTAGCTCCGGACGCTGTTTTAACGCTTGAAAAAGCCGCACGAGCTCGATCTCCGAATAT
TTATACTTGTTCAGCAAGGAGTTGAATGTTTGCAAGTCGGACGGATCACGCGAGACAGTCGACCAGTACGTCTTGGAGTATTGGAACCACTGCAGAAACT
TGGAGTTGTCTTTCAGCTTGTCTTGCCCCCTTTGAATACAGTATCTTAAAAACCCTAGCGGGGGTTTCACGAGATTTTAGCCACGCCGCGTTCAGCAACT
CGCGCGAAGATGCCGAGCTTTCGGCCAAATAAACCTGCATCATTTCAGCTAAATTCTTCCTGGTCGGGATTTTCCGAAGCGACTGGGAAAGTGTCACCAG
CTTCGCTTCCGATTGGGATTTTAGCAGCAACCGAATGACTTGATCGTCGGAAAACGAGCTGAACTCTAATTTCGCTTACGTATCCACGTAATTGAGCCAC
AACAGAAATCGTGGGTTCTCATCGAGCTTCACGCTGGCCTCTCCAAGGTGCAACATGTTGAATACGAGGGTCGGGTCCGTCTGTGACTTGAGCCACAACT
TGTTAGCGACTTTCTGGGCAGATGGACTAATCTTCGACACCGCCCCTGCAAGTGGCGATAGTCCCGGGGTGTAAGCCCTCTCCGAGGCGTCCTTGATGTC
AATCTTGATGGCTCTTGATACTCTTGCTTCCTCAATCTTCTCCCCCGTGTTCAACTGGCGTGGGTTGGCGGAAATTCTCGCTTGGTCCGGGTAATAAGCG
AGAGCAGAAGCATCGCCAACCACCGCGCTAAGAAGGCAGATCGCTAGCAAAAAAGCGCAAAGGAAACGCGTGGTGCTTGACTCGGGGGCTTAGGTATGTG
GAAGATGCGATGTGAGGACTAGCACTGTGTGTTTGGCGTCGAAAAGCATGGCAGCGTAAGCACCGCTCAGGATGTAGTAATCATTAGGATTGTGTGAAGG
GATTGGCTCGATTTACTTTGATCACAGTGCAGCTACGGATGCCTTACGAGTACGTGCAGTACATTGTCTTGTACGAGTTTCAGCATCTATAAATCATACG
AAGTGCTCGATTTCAAATTTGCGTAATTCATGGTAGGCTATTATCACAAAGTAGTGTGCACAGTCCACCTCAAGCACGATTGAGGCAATTTAGAATTTCA
AAACGAAGAGGAAGCCAGACTTGGGGGGATGGCGGGTCTAAGCCAAAAGTGACCGCCCCGCAGTTCGAGTGGATGGAAGCTCCTTTCTAGAAGCTTCTAC
AACCACCCTACATCTGCTCTATCCTATTATGTCCTTAACAATGCGAACGATACCTACGGTACTGTTACCTCTCTAATCTGATACACTCACCCCTTCCTGA
GATGAGGGCTGCGTCGCTTCGTCCTCGCGGCTCTTCAAGGTACAGTCGTACTTAAGACAGATGGCTACAAAGCCAACAGAACTTATCCTTGCCAAGTCCG
TACTTAACAGTCTTTTCTCGATTGGACGTGCATGGCGCAACAGTTGGAGCTCTCGGGCGACTTCTGTGGCGGATTTGTCCTGCGCTGGTTGGTGGTGTAC
TCCCCCGGTCGGAGCTGGATAGGTCCTGCCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCCTTCGTTCGCCGTGAGAAGCTGGACCGTGGATGCTACCTCGTGTGCGCGGGTCAGCACCG
CCTCGATCACTGCTTCGTTCTCGTGGTTCGACTTCACCGGGGTCCGTTGATGACATATGATGTCTGGGAAGAGTTCGATGATCTACCCTGTGGAATGGAG
CGATTGACGAACATCAAGTGGATTGACACCGTCAAGGCCATCTATCGCATCAAGGAAGGGCCCAAACCGAAACCACCACGCGGGAAGCGACTCACCAGGA
CTGCGAAGAAGCGAGCGAGAAAGGCAGTGGCAAAGTCAGCCAAGAACGCTAAGAAGAGAGCCAAGAAGCGCAGCCAGGGATAGGCATGCAGCCAACCGAG
AATACATGTGGCCTTGAGCTCCCTTTCATTGCTTTCTGGTTCGTCGTCTTCGCTTCACACGACGTTGGGCTTCGAATTCCGCGATCAAGTCTGGCACTTG
CTTCAAGTTTTCAACCGGCTCCCATGTAGGCTTCTCTTCGCCCACCCACTCCACAAGGAATTGGGTCCGACGTTTGTGGCGACGTTTCCCTAGGAGTCGA
CGCACAAGTTGACCGACAGTGCCATCCGCGAGGATGACGTCGTGCGGCCGTGACAAACGACTCGGTTCCTTGTAGGGCTTCAGCGAGCCAGTGTTGAAGG
CTGGATGTAGCTTGTTACCAGCCTGGATGTTGAGCTCGTAGGCATGGTTGTGTATCTTCCGCACGATCGTGTAGGGTCCAATCCACTTCGGTCCAAACTT
GGTCGAATTCGGCAAGCCAGAGTGCTGTGGGTCGAAGTTTTGCGTGCTCAAGTACACGCGGTCGCCAACGTCAAAGACTTGTTCTTCACGGTTGCGGTCG
TAGACATATCACACATTCGCTCCTGCGCCTGGGTCAATGCTTCGCGACAACTCAGCAAGATGGCGGCTTGGCGCTCATGGAACTCCGCTCCTCGTCGACT
TTTGGGAATGCTCTCCAACTTCTCGGTAGCAAGCTGAAGAGGATTCAGCGGGATGAATCCCAGATCGGCCTCGAATGGCGCTAGCTTCGTGCTGGAGTTG
ACCGTTGAGTTGACGGAAAACTTAGCGTTCGCTAGATGAAGATCCCAATCATCCTGAAGTGGACCAACGAAGCAACGAAGATACTCCTCCAGCGTTCAAT
TCATACGTTCCGTTTGCCCGTCGCCTTGAGCTCGGTGAGCCACGGACATGCTCAGCTTCGTCCCGATGGACTTGAAGACATGCTGCCAGAAGGCGGACAC
GAACTTCCTGTCGCGGTCAGAGACGATATTCGTCGGCATGCCGTGTAACTTCCAGATGTTGTCGATGAAGAGTCGAGCAACACCTTCGGCGTTCACCTTC
TTGGTGGTTGGCACGAAATGACACCGCTTGGTCAACCGATCGACGACGACCCAGATAGAGTCGACGCCCCGTTCCGTTCGCGGCAGATCAGTGATGAAGT
CCATGGAGATGGATCTCCAACGCTCGTCTGGAATACTGAGTGGCTCGAGCAACCCAGGAGGTTTCGTCAACCGCGGCTTGCTCATCCGACAAGGCTCGCA
GTCGGCGACAAACTTCTGGATGGACTTCAGCATCTTCGACCAGTACCAGCGGCGCGCTAGTGTCAAGTATGTTCGCTCAGCACCGGGATGGCCGCCGTAG
TTGGTGTCATGACACTCGCTGATGATTGTCTGCTGCAACTTTACATCGTTGGGCACGACAACGCGC