Description :
From Genome Similarity Track
Location :
Scaffold_54:67185- 68419
Transcript NameFunction/comments
Physo_137434OSJNBa0080E14.12

Sequence
1234 bases(100 bases per row)
AGTGCCGACCACCATTTTTTATATGGAGCCAATGATCTACATGTAATGCCAGCGAGGTTGTCCGAGATCCAGGCGGACAGGTTTAATTTGTAGGCCAAGA
GCTCAGCTGCGTGGACGTAAGACATCCTCAGTTATCCGTCAGTAACTAGGAACTATGCAATACAGTGTTGTTGTAGGCTGATTGGTCATCCTGCATTCTC
TTGTCGCTAACGTTGCCCTGATTTCATTGTCAATTGGCTTTGTGTGGTACCGGTCGGGATGTCAATATGGCTATATTTGTGTAGGTATGGTGTCGCGAGA
TGTTGTTTAAATGTTGCCTGAGGTACAAGCAACCTTTTTTCGACGAATTAATCTGTGTGAGGATGTCCATACAGCTCTTCTAGCTGTCCTCCCAGGATAA
ATACTTTTCAATACTAAATGTATCAGATTAGAGAGGTAACAGTACCGTAGGTATCATTCGCATTGTTAAGGACATAATAGGATAGAGCAGATGTAGGGTG
GTTGTGGAAGCTTCTAGAAAGGAGGTTTCATCCACTCGAACTGCGGGGGCGGTCACTTTTGGCTTAGACCCGCCACCCCCCCAAGTCTGGCTTCCTCTTC
ATTTTGAAATACTGGTAGCACTTGTTGGTCCCAGCAACCTGACAACGAGGAGATCATGCCCACCATCGCCCAACTACGCGCCGAGATCGATCGGCTGAAC
CAAGCGATGGCGGACCGCACGCGAGTGCCGAGCAACCTGCCGAAGTTCACCGGCAAGCGAGGGGAGGATGTCCGCGAATGGCTGTTCCAGATCGAGAACG
CCTGTCGAATCAACAACATCCCGATCGAAGACGCAAGCACCCGACTACCAGGAATCGCGGGGTCGGCGATGGAGAAGCCTGCCTCCGGTTGGTTCCTGCA
CTGGTCGTCGACGACATGAAGCGAGGAGCACACGTGGGGGATTTTCCGTGAGCATGTGCTCCAACACTTCGAGGCATCGAACTACCAGGCTGTCCTGCGC
GAGAAGCTTCAGCGACTCAAGCAGGTAGCAGACATTGAGACGTACAACGGTGAGTACTCAGCTCTCATCTTCAGAGTGGAGGGCATGAGCGTACTCGACC
AAGTGCTGTACTACGCGAACGGTCTCAAGCCTCGCACGCGCAGATACGTCAAGCTCGAGAACCCCCAGACCCTGAGCGACGCTATGGACTTGGCTGTCAA
GTACGAGGTGACTCACTTCGTCGAAGAAGCTCGC