Description :
From Genome Similarity Track
Location :
contig_45:67164- 68280
Transcript NameFunction/comments
g9889.t1ETI43712.1 hypothetical protein F443_11444, partial [Phytophthora parasitica P1569

Sequence
1116 bases(100 bases per row)
CATGACGCCCGTGCAGGCCGCCACGCTGCCGCTGTTCCTGTCCAACAAAGACGTGTGCGTCGACGCGTGCACGGGCAGTGGCAAGACGCTGGCCTTCGTG
CTGCCTATAGTGCAGCTGCTCAAGGCCAAGCTGGCGGACGGCAGCATCACGGCGCCGCGTCACGCCGATCTCACCAAGCTCGTGGCGATGGTCGTGTCGC
CCACGCGCGAGCTGGCACGCCAGATCTTCGAGTGCGCCGAGAAGTTCTTTGCTGGCGCCTTGCCCGGTGTGCAGCTGCTACTGTTCGTGGGCGGCACCAG
CGTGGACGAGGACCTGTCGCTCATCCGCGGCGCGGTGGGCAAGTGTTCGGTGGTCATCGGCACGCCTGGCAGAACCGAGGACTTGCTGAACCGCTGCGTC
GGCTCCAGCGTCGAAACGCGCGAGTTCGAGATGCTCATTCTGGACGAGGCCGACACGCTGCTGGACATGGGCTTCGAAGTGAGTCTCAACAAGATCCTGG
AGCACCTGCCCAAGCAGAGACGAACGGGCTTGTTCTCGGCCACGCAGACGCAGGAGGTGAAGGCGCTGGCACGCGCAGGGCTGCGGAACCCAGCAACGAT
CTCCGTGCAGGTGGCGAACAACACGCAGGTTACGCCGACGACGCTGCAGAACTACTACTGCTTGGTGGGCCACGACCAGAGACTGTCAGCGCTGCATCAC
TTTGTGCAGTCCAAGAAGGGCCAAAAGCTGATTGTGTTCTTCTCCACGTGCGGCTCAGTGGACTTCTTCACACGCGTGCTTGAGGAGCTATTCAAAGGTG
ATGAAGCCATCCCTGTTGTGGGGCTGCATGGAAAAATGCCTCAAAAAAAGCGTACGACGAATTATGACCGCTTTTCGTCGCTGGAGTCGGGACTGCTGGT
GTGCACGGACGTCGTTGCCCGAGGTATCGATCTGCCGGATGTAGACTGGATTGTGCAGTACGATCCGCCGCAGGACCCGAACTTCTTCGTGCACCGAGTG
GGTCGTACAGCACGTGCAGGCCGATCTGGATGCGCCCTGTCCTTCTTGTCTTCGAACGAGGACGCGTATGTGAACTTCCTGAAGATCCGTAAGGTGCCGT
GCGAAGAGATGACACT