Description :
From Genome Similarity Track
Location :
scaffold_209:6715- 9875
Transcript NameFunction/comments
Pl_107667conserved hypothetical protein

Sequence
3160 bases(100 bases per row)
TTTGCCATGGTTGTGTCTTGACGCTACCATGCTTTCTAAGCATCAGGCTGTTGCGCTCCTTGAACCCCTGTACCCGTGGGTTGGAGGCCACAAACGAATC
GGATGGTCTTTGTGATCCTTTTCAGTGCGACTTGTTCTAAAGAGGTCAATTCCCGTGGACGCAATTGACCCTTTCTTTTCGGAGACGTTTATCATTGAGT
AGCTCAATCAAGTAGTGGCTGTCGAAACTGGTCGTGGTCGCGCCACCACTTGCGATAGGGTGACGCCAACACTCGTCACCCAAGTGGTCGTAAGTGCGGT
TCTGCACGAGATGGAACTCCTCCTCCTTCGGACTCGATCCAGTCAATTGCCTACTGCTTGAGCGTGATCGCGACGGGCTTGCGTAGCGAAGCCAAGGAAA
AGGGAGACTGAGGACTTAAAAGGCAATGCATAAGAGGTTTGGTGAGTGATTGGTGCAGCGTTGGAGTGACAGAACGAATGGAGGTGAGAACTGCTGCGCC
TACAAGGTTAAATTATTGGTGTCAAGAGTAGTGATTTCGGCTGCACTGTCCGGATACTGAAAGGTTGCTGAGGGTTACTGCATTCTATTCGATCGCACTA
TTTTTAGAGTGCACTGTTAGACCACTCTGTTCCCAGGTACACATTTTACTAGGGAAACTCTAATCGGTTCTATACGTTATATCACACTGGATGTTTTATA
GCTCATTGTGGCTAAAGTCGGTAACTTCTTTTGGCGAGCAGTGTGATGTTGTACTGTAAGAGCATTTTTAGATTTTAGATAGGTTTTTCATAGTTTTGTG
GATATTTCTTCAAACTTCTAATTGATTTGCATTTTTTCACAATATGGTCATTCTGTATGATTGATATGCTAATCAGGAAAACCTTTGAAGGAAATAACCT
GTTAGCTGTTGCTTATATAACTTGTAATCCTTTGCAGGTGCTCGTTGCTCGTGGTTGCATTAGTTTTAATTTTTACTTAAACAGCTTTCAGAAAAACCAT
GTAGGATAAAATCTTAGTATACCTTATTCATTTTGTGTACGTATCGAGTTGTCAATGAGCCTGTAATACAAATTCGTAATTAACTATAGTTTGATCTATA
CTACAGATCATGAGGCGATCACAAGAATGACGAGGAATGTGAATATGAAGCAACTACTTCTAGATATTGTTAGACCGTGTACGCTGAATCTGCGGTAGTT
GCTGTGTGTTTTGCAGCTCCATGCGCAGCTCACTCGTCTCACGTCTTGATGATGCAAGGTCGCCTGTTAGCCGGCGGTTTTGCAGCGTGAGCATGCGCAC
CTGGTGCTGCAGCTCGACAAGCGTGGGATCTTTGGGCAAACGGGGTGAAGATGAAATATTGGAGGAGCCCGTGGTGGAGACTCGGATTGACTTTAGCGCT
GCGTTAACTGTAAATGCCAAGTCGTCGCGAAGTCGTAGCTGCAATCATTCAAAATGAATGCTCTGTGAATCAATGCTTGCAAACACAACGTGGTGAGCAC
TTCCGTACCTGCTTTTGATGGTCAATCTGTGCCGGGAGGGGGTGAGGTTGGTCGGAACTGGTCGAAGTGGAGATGACAACCTAGATACATTAATATGCCG
TGAATGATACTGTTAGTGAATCGCTTCTGAACGACACTGTTCATCATGCACGAATTACCTCAGCACTGATGTCTGCTATCTCGTAGCTGGTCCATACAAG
TGCCGCTAGCTGCCAACAAGACACCTTTGTGAATCCACAGTACCTAAAGCTAGTATTTAATCCATGATGACTGTGCCTCACCCTCTTCTTCTTTCTCTTC
GAGTGCGGATCAATTCCAAATTTGTTGTAGTACTCCTTTCGTTCAGAAAGAGTTGTGTTATGTTTCAGTCCGTTGTATACCTTTCCCCGTTCTTCTTTCA
TTCTCTTAGCAGTCTGTTGATGATAGCAGATAATGTTAGATAGAATCTGTTCGTGGACGAAAGAATGCTACGCTCACTTACAACTTCCTTGATTGTCTTG
TGAGGGGCACTTTCTCGTGGACTCACGATGCGTTTAATCGCAGTAAAGGCAGATCCTCGACCTTCGTTATGCTTCGTGGTATCTTTCGGATGCACTAAAG
AATGCGTGCACCGACCTGCAACATCCGGCGATGTCTTTGCCTCAGAGAAATATGCATGAAGCCGGCTTTCTTCTTCGAGGTAAACCTAACACGAACATTC
TCAGGTGTTAGTAAACAGTCATAAGATTCGTGGATTGTTTGGGTGCTATGGGATCGTGTAAACCAACCCCGATAGTGAAGAAGTTTGCTCGGTTGAACGT
GAGCCAAAACTTCGACCGGTAAAGCAGAGGTGTATCACAACGATTCCAGAGATCATAAATTTTTCGGCGACCGTCTTCGAGCATGCCATTCTTCCACCTG
CATGATAATGAACAGGGTTAAATGAATTGTTCGCGAAATAAACTGAAGCAGCATACTTGGTAGAATTCTTCCGCGATAAAAATCCTCGGGTTCGGCTCTG
CGCTCGCACAACTTGAATTTTCAAATTCCTGTAGTTCGCCTTGTAGAAGCTACTACGCCACAACGCTTGAAGGCGACAGAAGCCTCGTGTAATGCGCCGA
TATCGCGCATATACAATGTAGCCTCTAACCATAAATTGCAGCTTGTGTAGCGCTTTACGTTGCATCCGATATTTTTGAATTGCGTGGTGCATGCGGTAGT
TTTTCTGGATTATTGTCGCTCCATTTCGCAGAGCTAAGAAATTTTGGCGGTGATCTCGCCCCTGTTGCAACACACATTTTTGGTTCAAACTTTTCCCAAT
GGTCTATGAAAATCTGCCAGCGATACCTTTATCCAAGCAATAACCGATCTCTGGATTGATACAGCAGCGCTCCTTTGTCTGCGATATTTCTTTCGAGCTA
TGTACATTCGAAACTGGGTCTGAAGCTGTTCACAACGAAGTGGTCAGTGTCGTTGATTAATAGTAGTCGCATTAAGCGTCAAGGCACGAGTTTTATAACT
CGTACACTGATGATGAGATGGCGAGTGGCTTCCCAGCTCGCGCCGTTACCAATGAATGACCTGCAGTGCAAATTTTGTTGAGAGCCTTGCATACCATCCT
ACCACGATCCCAGCTCGCACTTACGTTGATGTCCTAAACATTCCTTGGTGGAAGCTCACG