Description :
From Genome Similarity Track
Location :
Scaffold_43:6715- 8827
Transcript NameFunction/comments
Hyaar_Emoy2805795PREDICTED: E3 ubiquitin ligase BIG BROTHER-like
Hyaar_Emoy2805796exonuclease 1, putative

Sequence
2112 bases(100 bases per row)
ACGGCTGATTAGTTGACAATGGAGCAACTAATGATCGTATGCACACTAATCAGAACATTGCGGCATACGAAGAGCGCGAAGCTCGCTTACTCCAGGCGTC
TGCAGGTCAAATGTTTAACCAGCGATCTCACGAGCACTATAGTTCAGTAGTCTCAAGTATATTGGACCATCAGCACAACATCGACCCGGACAATATGACT
TACGAGGAACTGTTGAGGCTCGGAGAAGAGGTCGGAGACGTGAAGCAGGAAAGATGGCGGCAAGTAGCGGTTCAAGTCATTTCGGGTCTACCGACCCATC
AATGGACCGAAAGCCATGGCGAAAACACGTACGTTTGCTGTGCATTACTGTCTAAAGGTTGTTGCTGATCGATATGATCGCGCAGGTGTGTCGTTTGCCA
GTATAATTTCATGCTGAACGATCGTGTCATGACTCTTCCGTGTGCTCATGTATTCCATGAAGGTAACTTATTCTCTCTAGACAACTGGACTGTGAACACG
TCTTGACCGTTCGTGATTACCTTGTAGACTGCGTCGATAGCTGGATCCGCGAGAACAACAGTTGTCCACTGTGCAAACGGGAAATCTCTTCTATGTAGAA
TATCGATAATGGGACGAAAAAATATACATTGCAACAAACGCTCAAGGGACAATGAAAAAGTTCTAGTGCTTGAAGCGGAACCGCTCGAATGATGCAAGGG
ACGCCAATGACCTACCTGTGGCGACCTTTGATGTATCAACTGCGCGTCGCTGGCCAAATGTACTGACTGTGGCTTTGCGAACGATATCGACGCAACTTTC
ATTTGAGGTATCAGGTGTACAAGTATTTTCTCCTTTGCGGCCATCGTTCAACGTGGCCGTGGGCAGTTCGCGTGGCACCTCGGAAGTTACGTCGGGGTTC
TTCTCAGCTTCACCCGGCTTGTCTCTGTTTGAAAACACAAATCGTTCAATTTGACCAGAAGTATGAGCTTGATGCGTGATGTGTAGTTTCCTGCTGCGAA
GTCCTGCGCCATGCGCCTTTCGTTTCTTCACATTATGTTGCTGAAGCATCGAGCCAGCACGCATCATCCGTGAAAAGGCTGTTTCTTTCGCTACCGACGG
GACATTTTGCACTGCTTCGAGGAGATTCGGCGCTCGGTTTTCTTTAGAAACCCCGTCGATTCGAAGAGTGAGTAATACTCTGCTCTCGTCACTCTGCGGG
TCAAAAGTGACGTCCTTTGCCAAGTCAATCTTACACGTCTCCTGACTTTGATACGATGATCGATCCATTGAACGAGGTAGACCCGATGTCACAGATCCAT
GAAGCGGTGACATCTTTTCAAGATTCTTCTTCCCGAAAAAGCGGCTAGTCAGAAGCGGACTAGCCGCTATGGTATCAGCAGCTGAATCGACTGCCAAGCT
ACGCGAGCTTTTCGTCGTGGGCATCGCAGTGGGCGTCAACTTGTTCGTATTCATGAACGACACTCGAAGTTTTCTTCTTACATCATCTTGGCGCAAACCA
GGAGCATTGAATGCAGCCACTGCGGCCAACTTGGAAGCATGAATGGATGGTGTGATGCCTGCTTTCGGTGCGACAAGAGGTGCTGCGGGTTTTTGGACTA
CGGACTCATCAGGACTTGACTGGAACGACATGTTGCTTGGAAGTAGTACCTGCGTGCGAAATCGCTTCATAGTGATAGGATCAACATCTCCGTTGGCAAT
TTCCGTTGCGAGGTCGCTAGGTAGTACTGGTCCCACGAAATCCATTGTAGGGTCACTTGCTAAAAGATTTAGTGGAATTGGTGTAAGAGGAACCAGTTCC
TGTTAAATAGACAAAACGATGGTGTCACGAACAAGTCAAACAAAACCTTTGACAACCTTGACGGCTCTCTCATTAACCATACAAAACTCGAGCACGTTTC
AAACCTTTTTATCGGGACAATATACGCGTTGATGCCGGAAAGTCAAGACTGCCTTCGCAAAGTCGTCTTCGTAGGTTGCTGGAATTTGCACCTTACCTTC
AAGACGCAACGCACGAATGATCTGGAAGAATGCAATGAAGTCAGGACCCGAAAGACAGATTGACACAGTATGCTCGTCTTTTCACAATAGACCTTTGCGA
AAGAACCGTGCT