Description :
From Genome Similarity Track
Location :
Scaffold_22:6715- 8662
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06378Protein ZK632.12
Sappa_CBS223.65SPRG_063791-phosphatidylinositol-3-phosphate 5-kinase

Sequence
1947 bases(100 bases per row)
GTGTCCGCTGCTCCGAGGCTGTTCGGTCCGGCCCGGCGTCCAACCTCGTGGTTAGTGGATACAGCACGCCCCACTCGGATGCATCGTCCGAGCCGTGGTG
GACGACTGAGCTCATGACGCCGCCGCCAATGACCCCCGTGGCGACTCCCAGAGCGACGCCGAAAGCGAGCCCCAAGGTGGACCTTTCGTATTTATCCACG
TTTGGGCCCAAGTAGTTAGGACGTTAGAAAGTAATAATTCATCTAGTAGATATAGAAAGAGTAGGCGCAACACGAGTGGACTCTGTAGGTTTTGAGCTTC
ATTTTGTCGATTTGAGATTTGCGCGGCAAATCTCAAATCGACAAAATGAAGCTCAAAACCGAGACACAAACACAAAAGTTGACACGCGCAGAATATATAA
ATTCGTGTCGTTCCCTACATGATGTACTTCATATACATCGCCCCGTATGAACCCTATTGGAGGTCCTGACAGTAGATTAATGGCGTTGAAAGAATCAAAA
CGCAAAGCGTGGATATGGGTACCAAGGGAATGTAGAAGAGGTCTAGGTATTATTGAGCAGTCGCTCGTGCATTACGATCGAAGCAACGTAGCGATCTGAA
TGTGTAGTAGGTAATACTCGGCGCTCTGTGGAGCAATCCGTTGCCATGCAGGCTAGTACGTTCGAGAAGAGTCGTGCACGGTCTCAGAACTCTTGCCGAT
AGTGCTGGTAGAGCGCTCGATCGGCTTCGTTTCTGCGTGCATTCAACCGCCATGGTTTTCGCTCGTCTTTACCTCGAAGAAGCATCTGCCGCCGCAGCTT
CAAGGAGCGAGCAACACGCATCCCACGTCGTTTTCTTCATTTTCAACGACACCATGTATGACGCTTTTACGTAAAGCTGTCGGCGTGCAGAGATACGACG
GGCAGATTTCTTAGCTTCTACTTCGGACATGTCGTCGTCGCGAACCGATGCGCTTCAGCTGAATCCTGAATCCCGTGGTTTGCAAGACATTTTCGAGATG
CAAGCGAAAAGGAAAAATCGTGTTACGTACTGCACTGGGACTCGCGGACATAGAGAGAGAGGCGCATCGAGTGGCGGTTGACGTGGTCGAGGAACTTTTC
AAAGGCCGGGTCGTCCTCGACGTCCATGCTGCACTTGCGTGAGTTGGGCTCCGACGAGAGGCCCGACACTTGGCTGCTCTCTTCGTCCAGCGAGTTGGTA
CGACCCTTGTTCGGGTCGTGGTAGAGCGTGAGGTACGAGAGGTCGAGCGTATCGAGGCCAAGCGCAACGCTGCCGCGTCCCGTCGCGCTCGAGATGGAGC
TCTGGCGGTGGCGCGCCGGCACGGGTTCGCTCTGCGACACGTCGATCCGGAGGCGCGCCGGCGACGTCTCGAGTACGTTGGAGGACGAGCTGGCCTTGAA
GAGGCTCTGGCGGGCCTCGGCGTGCGACGAGATGTCCGAGGCTGGCGTCGCGCAGACGCTCGAGCCTTCCCAGCCGTTCCGGACCGCGTCCGAGCACGTC
GCGCAGACGCGGACGCTGGTCCCGTTGCCGCTCGGCAGCTTCCACTTTTGGCTGCAAGACGAGCACACGGATTCGTTGCAAGATTGGCACTGGTAGCTCT
TTCGGAACCGGAACGACGCGTTGCAGTGCACGCAGCGCTTGGCGGCGGCGGTCGAAAACACCGATGTCGCCGTGCTCACGACCGATTCGACCTCGGTCGA
GACCGACGACGACGACGAGCTCATCGAGCGCTGGAGCTGCGAGTTCAGGCGCAGCTGGTGGACGTGGTCGGCCGTCAATTTGACGGTCCGCGCGCGGTTC
TTGACCGCGAGCTTCCGCACCCACGTCGGCATCGAACCCTTGAAATCGTACGAAATATGATACACGACGTCCAGGACGCCGGGCTGGTCTGTCTCCATGT
ACACGCAGCCCGTGTGGTTGAGCTCGCCACGCACGAGGTCATACGCG