Description :
From Genome Similarity Track
Location :
Scaffold_27:671428- 673618
Transcript NameFunction/comments
Phyca_LT1534548194Monovalent Cation:Proton Antiporter-1 (CPA1) Family
Phyca_LT1534507490Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
2190 bases(100 bases per row)
ggtacgttaagtttatcgaaacaactcagagtagccaccgtgtccacagcactgattagcgtgccaaagagaaaggcttccacccacgaaagtttggtca
cgataccagccacgcctgctaagtacagaactccacctgtaattgtcgtggcgataaccgttcccagcacagccgtgctcatgattgctggaaagtttct
aaagaagaccgtgcacttaatggagaaaccaccttcgtagatgattggcggaagcaacacattaaagaagaggctgttgtccaagttcaggtgagtgtgc
agcgccgcgtgcttgccgcccataatcatgaagagccccacacagagcccaaacatgagtgcgaaactactctgtgaaaccagcatgcacgaatagcgcc
ccaacatgtaggacgccattaccagcacgaacagcatgagcagcagcagcaccgcgtcctccatctttgtcctgctctgtcttccttcgcactgctgtat
gagtctggcttcatttgattggccagcgcagcatgcgatacgccattttagtaagcaaaaccggttggatttgctgaactgaaagacttggattgagtat
gtaaacattgtgtgggctacgctaagcaaaaccggtaagttgaagttgctgatcaaaccgcactctgcatctgcatcttgtcaacatcccgtctgggtgt
atctgctgcctcctcctcttcgattggtcttctgttcgcaggggaccgatggccaccaaagtaaggctgcatgtatgctgtgtcgaaagcttgccaattg
cggatgaaggcgccggtccgagtctctcggtgttgggtaggtgagtcaccatcattctcactgtaatcttcatctcggaactgtggtcgtgatgtaaaca
cggggtctcgctccagctcaatctcttggtctcgtgtagtagacccttctgatgctctttgttcggcttgctgctcggtagctctggagtttcggcgaag
catgaagtgacgtgtactgcgttgcaacacccgtgcttgatcttcctcggagctcgactctccttctgggttcggctcgtgatcagattgacttaaacgg
ctgtggtaattggttagacgcaacttatagaggagtggaccggtcagtccgccaataacaattgttgtaaaaagcaccacgacgagagtggtggactcca
ctaactgacgatgagaaccgtagcggccgatataattccaattcttcgcgagtgcgaacgcgatagagccccgaagaccaacgaaccacattacactcat
atacttgagtggaattcggtcggaagactctcgcgaccagttcgaaagttgtaacagcgggaaaatgttgaaaaagcgcgctacaacacacgcgacgagt
gtaagaccaatgaagtgccagtcgatgtcgtccacccgtagagcagcacctaaacttttttctggatgtcccgaaaagatcatgatcaccgacgtcccca
tgaacacgtacacgacattttcacacacgaacgacaacgtgtgcaacaaatgcgtaaatgcatgccgagcttcacgggacagcacgttgaaatggtagtg
agctgtcatagttcccgagaaaaagagtgctacgatgccgcttaatttgagactgtcggcaacgtagtacgtcagcaaactgaagatcaagcacaggcaa
atctcatagcttgggaagaaatgcagcgacgaaaacaccttgcgcttgagcaggaaggcgccgcatagagtaatcactgcactcacaagcagtgatccca
caaacatccagctcgtattgaccgctacgtgaagcaactgcttcaaactcaagtcagtgccgacgttccatttgtgtagtgtctggtagagcgcaatagc
caccgcattattgatcacgctctctccaaacaccaggttaaacagcaacggtggaacgtgcagcttattaaagcacgataatgtcgccaccgggtccaca
gcattaataagcgttccaaacagtaaagcttctacccacgaaagtctcgtgaccatcttggactgcccagcgagatacagcacgccacccgtgatcgtcg
ctgcgacgactgtaccaacaacagccgtgttcatgatggccgggaagttgcgaaagaacgcctggcgcttgatagaaaagcctccttcga