Description :
From Genome Similarity Track
Location :
Scaffold_454:6714- 16002
Transcript NameFunction/comments
Phymu_g10049hypothetical protein PHYSODRAFT_314592

Sequence
9288 bases(100 bases per row)
GAATTCTGGTCATTGGATAAATGGGAGACGGAATACTCGCGCTTTATGAAGATGTTGGCGATTCCGTTCTTCCAAAAGTACAAAACgtggaagaacttca
acatgtGGAAACAATCCGTTCGCGCTTTCAAGACGCGCAACGCCAAAAAAGCTCTGAACGAGCGGCTTTTCCTCTTAGCTCCGAGTCTCCAGTCCACTTT
ACTCGGTCTCCGAACGCTCTGTCTTGACGTCACAAAGCTCGAGTTAATTCGCTTCAGCCCTCGCCAAACGTACTCGCTAGGGGATTTCGAGGCGGAACAG
CTCAAAACGCGAGCGCAAGTGACGCAACAGCTCGCGGAATtctcctccaagtcgctgaaAATGTGCGTCAAGGCTTgtgacgacgtcatcgacgGGTTTT
TACGCACCAACAAGATCTCCGCCGACCACAAGATGACCTTCATGGAGAGAGCTGCGCTACGTAAACAGTGTCGGACGCTCACGAACTTCTTGCGGCTTGC
AGACTTCTTGACGATTGACGCTACGATTCAGCTCACTGTTCACTCCTTTCAGCGGTTGTACACCGTTCTAGCGGCAGGAAAGGCTCCACCGACCGCTCCT
GCTCCCGAAAATCCGCAGCCAAACAGTAAAAATCCGGGGAAACCAGGCCAAGCGCCGCCTTTTACGGCCATTTTTGCCGTGGCAGTCGAGATGGATGCTG
CAACGGCCGCTTTAAACGCCACTCCGAGCCACGACGCGTGGAATGGAGCTCTCCAGCGCGCGTTGAAAGAGGCTCTGCGTATGGTGGAGACCCCAGCCCG
ACATCTCGGCCACGAATCGCTGGCGCCTTACACGACTGCGAGTGCGGAAGACGAGGGCAAAGACGTCTGGTCTGTGGAGCAGTTAAACGTGGCGTTGATT
CTCAATGAAGATGCCAAGTTCAGTCTGCTCACGAACGATATTTTCGTGGCTTTGGACGAAGCGttcgaggccgtggaggaTTATATGGATGTTTTCGCGC
CGTTCCACCAGATTTTCTCCGAGAACGAAGGCCAAGTGACGCAGCTAATGGAAATTTACGCTAATGCACCGCTGGATTTCTTCTCCGAGTCggtggagaa
gtacaaggctCAAGGGCAGTCATTCACGGAAATCCCCGATGCCGCCACGGTTGGGATTTTCCGCGTGGATTCTTCCGAATTTAAAAGTCGACTTCTGCCG
AATCCGGAAAAATGCATTCTTGGGATCCGTTCCTTGCTCCCGAAATTAATGAAACAAACCAGCACGGCGCTTCTCGAGACTCTCAACGACTTGTCGCCTG
TTGCTTTCTCCACACCGTCAACACCCGACGCCTTTGTGAAGAAAGTGGTGCACATGACCAAAGTATCCGCCATGTTGCCGGATCTTCGAAGTCGATACCG
ACGAGTGTACGAGATGGGCGTTTTGATGGATAATTACGACTGGAGAGTGCCGGATGATATCAAAGAGGATATTATCCTCATGAAAGAAGGCGTCTTGAGT
CTGGAGGGGACGGTCACACGCTTTGAAGGCGAAATCGACTCGGAGACTGCGCGATTTTCCCAAATTATCCTGGATAGTATCGCCCCGTTAAACCGGAACG
CCAACATGTTGCTTGAAAAGCTGGATCACCCCAAGCTTTCGACGGTTAAAACGCCCATGAGCGAGGCATTATCGTACTTACAAGCACAGGAAGATGCGCT
GAATCAACTGGTGGAGGAATCCAAGATGCTGGCCATGTTCCAGACGCAATTGAAGCAAAGCGTGAGTGAATTCAGCGAAATCAACGAAGTGGCAGCACAT
TTCGAGCTCAAAATGAAGCTCTGGAGCGGCCTGGACACGtggcagaagctggcggtTTCCTACTCCGACACCGTTTTCGATGATatcgacgtcgctgcca
tTAGTAAACAGGTGCAGATGTACGTGAAAGTGGCGTACCaagcgcagaagcagctcccAGGGAACGAAGCTGCCGACTTGCTGCAAAAAGAAGTGGAGAA
GTTTAAACTGGTTTTACCTGTTGTTTCAGATTTGCGCTCTCCGTCGCTAAAAGATCGACACTGGAAGCAGATTCACGCAGCTTTAGGATTCCAGATGAAA
GGGGAGAGCAGCATGACGTTAGGGGGGTTAATTGAGCGGAATGTGATGAAACATGGCGAAACTATcagtgcagcagctgtaTCCGCTCAACAGGAAGCTG
TTCTGGAGGAAATGCTCAAGAAAGTGACGGATGTGTGGGCCACAACGGAGTTCGAAGTGAAACCTTACAAAGAATCCAAGGATGTTTTCGTGCTGGGGAG
TGTGGAGGAAGTCACTGCGAAACTCGATGATTCTATTGTGACAATTAGTACAATCATGGGCTCCCGATTTATCGGTGCtatccaagaagaagtggaaggc
tggaggaagaagctcgtgactCTACAGGAAACTCTCGACGAGTGGCTTCTCGTGCAGAAAAACTGGATGTATTTGGAGAATATCTTCTCCGCTCCGGATA
TTCAGAGACAATTGCCGGACGCATCCAAGATTTTCAGCCACGTGGACGCTTCGTGGAAAACGATCATGCGTCGGACGAATGAGAACCCGCACGTGTTGAC
GGCGGGGACGTTCCCCGGGATCAAAgagacgttgcagcagcacaatggccacttggataaaatccaaaAAAATCTGGAGGATTATCTCGAGACGAAACGA
ATGGCTTTTCCCAGATTTTACTTTTTATCCAACGACGAGTTACTGGAAATCCTGGCACAGTCCAAAAATCCGCAGGCCGTTCAGCCTCACCTCCGTAAAT
GCTTTGAAAATCTGGTAAAACTGGATTTTGGCGATGTTCCTGGTAGTGTCGATATGATCGCCATGTATTCGTCCGAAAACGAGCGTGTTCCTTTAGGTAA
AAACCTAAAAGCACGTGGAAACGTCGAGGATTGGTTAAAAGCCTTAGAAGTGAGCATGAAGCAGTCCATCTACAAACTCATGAAGGCTGGACTACTAGAT
TACGACGGGAAGGCGCGATCCGCGTGGGTTTGTGACCATCCAGGCCAAGTTGTAGCCACTGTGGCTCAGATGACGTGGGCTCGAAGCACTGAAGAAGCCT
TAAACAGCGAAAATCCAGTGGACGAGATGCACGTCTGGTACAAACGCAACTTGTACGAGCTCAACGAGCTGATCGTGAAAATCCGTGGAGATTTAAGCTC
GTTAGAACGTAAAGTGATTGTTGCTTTAGTGACGACCGACGTCCACGCGCGTGACATTGTCGAGAGTCTCTGGACTGAAAAAGTCGATTCCGTAGGGAAT
TTTAtctggcagcagcagcttcggtaCTATTGGGACGCTCAGGCTGACGACGTGCTCATTCGACACTCGGACTCGGTCATCCAGTACGGATACGAGTACA
TGGGAGCCACTTCCCGTCTCGTTATCACTCCGTTAACGGACCGTTGCTGGATGACGCTCACTGGGGCTTACGGGATGAAACTGGGCGCAGCTCCGGCAGG
TCCAGCAGGAACCGGTAAAACCGAGAGCAGCAAAGATCTGGCGAAAGCGATGGCTATCCAGTGCGTCGTattcaactgcagcgaccAGATCGACTATAAA
ATGATGGGGAAGCTCTTCCGAGGACTCGCACAAGCTGGCAACTGGACGTGTTTGGACGAATTTAACCGAATCGACATTGAAGTTTTATCGGTTGtggccc
agcagcttttAATCCTGCGGGAAGGAAGAATCCAAGGCAAGGAACACATCAACTTCATGGGGATTGAGATCCTCCTGAAAGACCACCACGTTATCGTGAC
GATGAACCCAGGATACGCCGGTAGAACGGAACTCCCAGACAACTTAAAGGTCTGTTTCCGCCCCGTATCCATGATGGTACCGGATTATGCGCTGATTGCG
GAGATTATGCTGTTCGCTGAAGGTTTCGGTGACGCTCGCACGCTGTCCAGGAAGATGTGCAAGCTCTACATCCTCTGCAGTGAGCAGCTTTCGCAACAGC
CTCACTACGACTACGGACTTCGAGCTGTGAAGTCGGTTCTGGTCATGGCTGGGTCGCTAAAGCGCGCCAATCCGGATTTAAATGAAGACGTGACGTTAAT
CCGAGCTCTACGGGACAGTAACATCCCCAAGTTCCTGGCGGATGATCTGCCTCTCTTCCACGCTATTGTCCTGGATTTATTCCCTGGTACAGATATTCCT
CCGAATGACTATGGAGAGCTTCAATCTTCTCTTGAAGAGGAAATATCCAAGGCCGGACTGCAGAAAGTGCCTACGTATATTACGAAAGTTATCCAGCTTT
TCGACATTTTCAACGTCCGTTTCGGTGGGACGCTTGTAGGTCCTACCGGAGCTGGGAAAACATCGTGTTACCGTACTCTGCAGTCGACTATGACGTCTCT
GAGGGCGAAAGGCTCCAAAAATCCGGTCTACCAGACGGTCTACGCTCGTGTGTTGAATCCAAAGTGTATTTCTATGGGGGAATTATACGGAGAATTCAAC
GAAGCCACTCAGGAATGGCACGACGGCTTGGCCTCTACGATCATGAGAGAAGCAGTGGCGGATGAGACTTTGGATGTGAAATGGACCGTTTTTGATGGAC
CCATTGACGCCTTGTGGATCGAGAACATGAATACCGTCTTGGACGATAACATGACGCTTTGTCTGGCCAATGGAGAGCGGATAAAACTGAAAAACGAGAT
GAAAATGCTGTTCGAAGTCATGGACTTGGCCGTGGCTTCTCCCGCCACTGTGAGTCGAATTGGAGTCGTGTACATGACTGCAACAGATTTAGGTTGGATG
CCGTTCGTACAGACttggatggagaaggaactgcCTGTGGATTTTCCCCCCGAAGGATTACAGCGCCTGGATTTTCTCCTTACGAGTTATGTGGATAAAT
GCATCCACTTCgtgcggaagaagagcttcgagtACGTTCCAACGGTGGATATGAACCTGGCAACGAGTTTGTGTCGGCTTTTCGCCTGTTTGTTCAGTCC
TGCGGGTGGTGTGGATTATCTCGGGATGaaaaaagaagaaatgcTCGAACTTTTGGATAAAATCTTCGCCTTTTCGCTTTTCTGGTCCGTTGGGGCCACT
ATGACGATGGATACACACGAACACTTCGACGCTTTCGCCCGAGAACTCATGAGTGAAGCCAAGCTTAGTATCCCTAACAACGGTCTGGTCTTCGATTACT
TTGTGGATATTGAACAGGCCAAATTCCGAGCCTGGAGTGAGGTTGTTCCCAAATTTCAGTACAATTCCCAGGTGCCTTACTTCAAGATGACTGTGGCCAC
TCCGGATTCCGTTCGCTTTACGTTCTTACTGCGCACTTTAACCGCAGCCAAGAGACCTGCGTACGTCACTGGAGTCACAGGAACGGGAAAAACCGTGATC
GTTCAGGATTTACTGCAAGAATTAACGTCTGGGCCGATTTTATCCAGTGAAGGAGGGGAGGGGGAAGCTCCGTCCGCTCCAGCGTCAAATTTCATGACGA
TTTTCATCAATTTCTCGGCTCAAACTTCCTCTTTAGTCACGCAGTTAACGATCGAAAAtaagctcgagaagaagcggaagaaccTCTTAGGCCCAGTGGC
TGGCAAGCGGATGATTATCTTCGTGGATGATGTGAATCTCCCCGCAGTGGAGGAGTATGGGGCTCAAGCTCCGATCGAATTATTACGCCAGTTCCTGGAT
TTCGGTGGATTTTACGATCGGGATAAACTGTTTTGGAAGGATATCGCGGACACaatgctgctggcagctgctgctcctgctggaggaggaagatctCACT
GCACCCCTCGCTTTGTGCGGCACTTCCACGTCTTGAGCATGTATCCGGCAGGAGAAACATCTTTGAAGCTGATTTTCGCGTCGATTTTAGGCGGATTTTT
TGAAAAATTCGCTCCATCCGTTAAGGCCATGAAAGACGGGATTATCTCGAGCGTTATTGAGATTTACAACCGCGTAACGCTCGAGTTACTGCCGACGCCC
AATAAATTCCACTACACTTTTAATCTTCGGGATGTTTCGAAGGTTTTCCAAGGGATTCTCATGGTCACACCTGGGAAATGTCCAGACGCAGACTCGATGA
ACCGCCTGTGGGTGCATGAGGCCTCCCGCGTGTTCCAGGACCGTCTGATCAACATGAGCGACCAGATTTGgttcgaggagctcgtgtgctcgttgctgca
gcgctttTTCAACTGCAATTGGGCCCGAGAGACGCTTTTCCACTCGCCTTGTCCTTTAACGTTTGGGGATTTTTTCAAACCAGGAGCTCCTACGCCGCTG
TATGAGCACTGTAACGACGTCTTTAAAGTTACGAAGATCATGGACGATTTTTTGGAGAATTATAACGTCACTTTTGCCAACAAAATGAATCTGGTCTTCT
TCCGAGACGCCATCGCGCATTTATCCCGGTTAGTGCGGATTTTACGTCAGCCCAGAGGCAACGCGATGCTGATTGGCGTTGGAGGGAGCGGTAAACAGTC
CCTCGCTCGCCTTGGGGCGTTCATGGTGGAAGCCAAGTGCGTGCAGATCGAAATCACGAGAGGATACGGTACCAACGAGTTCCACGAAGATTTAAAGAAG
CTCATGATCAGCGCAGGCGTTGGAGGGCAATCCACCGTCTTCCTGTTTACAGACAGCCAGATCGTCGAAGAGAGCTTTTTGGAGGATATTAACAACGTTT
TAAACAGCGGAGAAGTGCCGAATCTCTTCCCTCAGGATGAAATGGACCGGATAATCGCAGATATGCGGCCTGTTCTGAAAGCGATGGATATTCCCGAGAC
GAGAGACAACTGCGTGTCCACGTTCATTGAAAGAGTGCGTAATTATCTGCATATTGTCTTGGCCATGTCCCCCGTGGGTTCAGCGCTTCGAATCCGTTGT
CGAGCCTTCCCTTCGTTGATTAACTGCTGTACCATCGACTGGTACATGAATTGGCCACGCGAAGCTCTGCAATCTGTCGCGGATCGGCTGCTTGCCAGTG
TTTCTTTGCCTTCCGAAGACGTCCGGACTGCTCTGGTGGATATGTGCTCGATAGTTCACACAACATCCAACGACTTCGGGGACGACTTTCTCGCCCAATT
GCAGCGATACGTGTACACGACCCCTAAAAGCTATCTCGATCTCATTGGATTATATctcaaaatgctgcaggagaagcgtgcggtgctgcagacgatcaAG
AACCGGATGGAAGTAGGTGTCAAAAAGCTCGAGGAGACCAACGGCATCGTGGATTCGCTAAAATCCGAACTCATCGAGTTGCAGCCGATTTTAGCCAAAA
AAGCCATCGAGGCGGAAGAATTGCTCAAGCGCGTGTCGGTAGATCAAAAGGCAGCGGCGGTTGTACGTGAAAGAGTGTCGCAGGATGAAGCTACGGTCAC
GAAACAAGCGGAGGAAGTGGCTGTGGTCCAGGCGGACGCTCAAAAAGATCTGGATGTCGCCATGCCTGCGCTGAATAATGCGATAAAAGCGTTGGATAGT
TTGTCCAAGAACGATATTACAGAAGTCAAGTCGTTCGCGAAGCCTCCAGAGGCGGTGGAGACCGTCATGAACGCCGTGTGTCTGCTtttcaacgagaagc
agagctgGGACGGAGCCAAAAAGATCCTGGCCGACGTGACGTTTTTGGAGAAACTGAAAAACTTCGACAAGGATAATATCCCGCCTGCCACTTTGAAGAA
ACTGGGGAAAGCCGTGGCTGAGCCTGGGATGGCAGTGGAAGTGGTGTCCAAAGTATCCAAAGCGGCCACGTCGCTCTGTATGTGGGTGCACGCCATGGAC
GTGTACTCGAAAGTGGCGAAAGAAGTCGGGCCGAAGAAGGAAAATCTCGAGAAAATGAACCAGAAACTGGCCGCAGCGAACGCGATTTTATCCCAAAAAC
AAGACGAACTCCGCGTGGTGAATGAAAACGTAGCCATGCTGGAAAAGCAGTGCAAAgacacgctggacgagaaggacaagctcGCGAATGACGCTGCAGT
GACGGAAAAGCGTCTGGTTCGAGCTGAAAAGCTCATCTCGGGATTATCCGTCGAAGGCGCTCGTTGGAAAGAGAGCGTGGCGTCCTTAGCCGAGTCCATT
CTGGCTTTAATCGGCGATACgttccttgctgctgcgtgtatTTCGTACTACGGACCGTTCACTGGAGGTTTCCGGCAGCGGATTGTGGACCAGTGGGTGG
CTCAGACTCAATCCCTCGGCATTCCTTGCTCTCCAGGCTACAGTTTATCCACGACATTGGGGAGTCCAGTGGAGGTCCGAGAGTGGCAGTTGAATGGCCT
CCCCACAGACTCCACGTCCACGGATAACGCGATTCTGGTGACGCGAGGCGAGCGTTGGCCGTTGATGATCGACCCCCAAGGTCAAGCAAACAAGTGGATA
AAGAAAACGTTAGCTCAAAAGCTGGAAAGTACGAAAATGACGAACGCCAATCTTCTCCGATCTTTAGAGACGTGTATCCGAAATGGAAAATCTCTGCTTA
TTGAGGATATTGACGAGACTTTGGAGCCTTCACTGGAGCCGATACTGCAGAAAGCCATCTACAAGCAAGGCGGGAGGGTTTTAATCCGTCTCGGAGACTC
GGATGTCGATTATGACCCTGCGTTTAAGCTTTTCCTtaccacgaagctgccgaatCCCCATTACTTACCGGAAGTTTACATTAAAGTGACTGTGATCAAT
TTTACCGTGACAATGGATGGATTAGAGGATCAGCTTCTAGGGGATGTAGTGCGTCACGAACGTCCGGATatcgaagagaagaagaatcgaCTGGTGGTGA
CGATGGCGCAGGATAaaaagcagctccaggagatcgaagaccgcatcttgaagcagctttcCGAGTCTGCAGGCAACGTTTTAGATGATCAGGACCTCAT
CGATACTCTGCAGTCCTCGAACGTCACGTCTCGGATCATTAAGGAGCGAGTTTTGGAGTCGGAAAGCACGGAGATCGAGATCAACCGAGCGAGAGAAGAG
TACCGTTGCGTGGCTACTCGAGGCTCGATTATCTACTTCGTCGTGGCCAATCTCGCCCTCATCGACCCCATGTACCAGTACTCGTTACCGTTTTTCCAGC
GGTTATTCAACATTTGCTTCGACGAAGCTCCGAAGGCTGAAAATCTGCAGAAACGATTGAACAACCTCACGGATTTTCAGACCAGATACATTTACGTGAA
TATCTGCCGGGGGCTTTTCGAAGTGCACAAGGTGTTATTCTCCATGCTGATCTGCTGTAAAATCCTACTTCACTCGGATAAAATCTCG