Description :
From Genome Similarity Track
Location :
Scaffold_70:67134- 68771
Transcript NameFunction/comments
g6125.t1hypothetical protein

Sequence
1637 bases(100 bases per row)
GTAAACTCCTGGATGCAAGAGCCTGTCTCGCCATCCCAAAGACTGCAAACAGAGCCAGCCACCACGGCAAATTTATTGGCGGAGTAGTGGTAAAAGGCAC
GGAGGGGAACTTCATCGAACTGTTGAACCCGTACACTACGAAGGTGTTGCAGCGTGCAGCTTCCTGATGTGGCAACCCAGAGATTCCGACTGTAAGGATG
CATGCTCACAAAGGAAATTGGCTCCACATGCACGGACGGCATTCCCAAGTCGACGGACTCGAGCTGTACTGCATGTGACGTGCTAGAAACTGAGGAGCTT
GCGTTCTCTCTAGTGATATCCCAGACCTTAAACACACCCTGGCAGTCACCAGTGATAGCACGCTCCGTTTGAAACAGTGCAAGCTGTATACCAATAAGTG
GGGCACGGTGGCCTGACAACTTGAGCACCACTTGACGAGAACTCAAATCCCAAGCTAGAGCCTCAAATTCAAAACCGGCACTTAGAAGCAGATCATGGTC
TGTGGAGTAGCAAAGCTGCCGGACGCCGCGCTCATGGGCGTTAAGAGAGCCACGAGGGCGGCCATCAGTAATATCCCAGAGCTGAATGTTGTGCCGTAGG
TCACAACTTACCAGCAAGTCATGCACTGGGATTTCAAGAACGTCTAGTACTAGGTCCGTGTGACTTGAAAGACGTCGCCACAGAATTTTGGTCTCGGCAT
CCACAACTTTCCAAATGTTCACCACGAAATCGTTTCCAGAGCCCACGAGTAGTGCTGAAGACTCACAAAAGCGCAGCGTCAGCTGTGCGGTAGTCGTCGT
AAGACCCAGATTTTTCAGCAACGCAAAGTTTCTGCCCGATGACGAACTCGTTGTCGATGGTATTTTCCTCGAGTCACTCATGTCGTAGAACGAAATGGCA
AAATCTGTAGTACTGACGCCAAGCCACTGGTAGCGGTAAATGAAAACAGCATCGAGAACCGACACGCTAGAAGCTGACGGGGGCGCTGCAGAGGTAGGAG
TCACAAAGGCCACGCCATCGCCCACGAGAAGAACATCGTTGATGGGCATAGCAAGATTGGATCCTGGGCTTGTTTGGGTCTGCTTTTCACCTCCTACACT
CACCTCAGTCACGAATTTGCCCTCACTCGTGAAAAGCTTCACCGACCGAGCCGCATTCTCCAGCACAAGGAACATCCGAAAGCCTGCTGACCACCTGAGC
TTCTCGATCTCCGTGCTGAGAGGGTTTAGAATCGAGCTGACACTCGTGGGGCCATGCGAGTTCGAGTCGGGCCCAGGAGTCATAGCTGCTGTCGTCTTCA
GAGCATGTTTGGCATCTCGCTCATAGCGATGTTTGAGTGTACCCACTTGAGACCTCATAGCTACCATGCCAGCATCGACACAGAAACTGGTGAATTCGTC
GAACTCCATGACGCCGTCGCCGTTGATGTCAATGTCCTCGAAGAGGTCCACAAGTGCACTCACACTGGCGGCTTTCTCCTCCGCTGTCTTGGGTCGTGGC
AGTCCAGGGAGCACAATCTCCACAAAGTCCAGAAGCGGCAAACCCCCACCCAATCTCTTCTCACGTTCACGAAATGCGTTCGCGATGGCCGAGAAGCCTG
CGCCCTTGAGACGCATCATGATGTCCATGGTGAACGA