Description :
From Genome Similarity Track
Location :
Scaffold_1:671141- 676764
Transcript NameFunction/comments
Physo_127171hypothetical protein

Sequence
5623 bases(100 bases per row)
CATTGGCACTGGGGGCAGTTGTTGATGACCTTCGCTCCCCCGTGCACTTCTCCTTGGTGAGTCTGTAGGTTGCCGCAAAATCCATGAAGCACGGGTCCGA
AGCTGCAGCGACCGTACATGTATGCCGCGCCCTGGAAGAGCTGGCGCATTTGTTCCGGCTGAAGCTCATTGTCCTGAAGTTGCTGCTTCACCTGCTCGCA
GGTGCGACCTTCGTGCCACTCGCGCGTGTTGCCGACACGAGGCGATCGGGCAGCGGAAGTGCGTGTCAATTCCATTGAGCACAGCCACGCCCCGACAGCC
TTCAACGAGGCACTTGTGCGTGTCGGGGGCGTCGTCCGCACCGACTAAAAGGAGTAACGCAGCATCTCGTCCTCCGTCAGCACCATACTCATGTCGGCGT
CCGATATCGTCGCAGTGCAGTCGGGACACCGAGGGCGTACGTTCTCTTGTTGATGCTTTGGAGGATATGCTGCTTGATCGTCTCACGACAGAAGCTGCGC
TCACAAGGCCTGACAATGAAGATCTCAGCCATGGGGTCTTCATCCTGGCAGATTGAGCAGTGGAATGCAGTGGGAATAGGCGGTGGTGGAGGAGGAGTTG
CAGCTCGACGTTGTAGTCCGCTCCAGCGCTCGTCGGCGTCTGATAACCCCCCACGGGCTGCATTCATCTCGTTGTTGAGGATGGAGATCAACGTGGTTCG
CTTCATTTCGGGGTCGAGGTTTCGGATGGACTCGGCTGATTGAGGACGGGAGTGACGGAGTAGATTCAGTGCATCCCCACGTAATTGTGGCCGCTTGAGC
GCCGAAGCATGGTGATTATCACTTCGTAGTCTTCTGCTGCAGCGTTCGGCGGCGGAGAAGAAGCTTGAACAATCGGGGCCACGGTGAGTGCCGCCATCCG
CTGCGCAAGCATTAGACCAGGATCTGAAACAGCGATTTCTTCTTGAGCTCGTGACTGATTCTGCTGACTCCAGAAGTTGTGGACACGACCGGGCCTGTAG
GTGTTGCTCGACGGAGAGAAAACAACCACCTCCATCAATAGAAGTTGACCGAGGTACGACACTGGTGGATCTCCTGTCGCAGCAACATAAGACTGCACCG
CGAAGTTCACCTCGACGCCGCTCCCTGAAGGCAAGACGCACACAGCTCGGCCTTGGCCATTCTCCTCGTCGTGGTGCACACAATCCCCGCTGAGTTGATT
GAACACTTGAGGTTGGTCCGGAAGGGAGGGAGGTGGCGGCAGCATACTGCCGTGTTTGGTCCTGATGTAGCGCCTATCGAGTTGAACGATCGATTGCATT
CGTTGCACGTAAGTTGACTCATTTAACTGGAAGACACTCAATACTGCGACGGATACAAGTTCGCTTAATGAACGCGCGTGTGGATAGATCCTTGCCCGCT
AAGATATTGTCCTCTAGCTTATTCTCGAGTTCGCACCCTGGGCCCGACCGTTACGAGGTCAGACTCGAAGTTTTGAATCTCTATTGATGTTAAGGGCTAA
CTATCGAGTCCTGAATTTTCTGAAGGTTAAGCCTAATCGATACGTTGTTCAGTGGTCTTCGTGGGCTGGTATCCCGAATACAACGTCTACACTGAAGATG
GGGCTAAAAGCGAATATCCCTGGGCCGATGGAACCTGATCGCAATAATTTAATCAATTTGGCTGCTCCGGGCGCCTTTTGTATCTTGCTTTTCTCCCACG
TGTACGAATTGAAGTGGTCGAAGAGAGTTGATCCTTGCGGGCGTTGTTTTGCCGACCACGCGCTAGCTACACATCCATTTTTGTAAAATCAATCGTTTTG
CCTTGTGAAGGACGGTTGAAGTTCAGTATCCTGTTCAAGGCCAACTTCGTGGACTCGGAACTCGTACACAACCATGAAAACCATACTTAAGTAGTCGAAG
AGGTTCTACAGTACAGCCATCAACACGTGGTCACGCTGAGCTGCAAGCCACAAGAACACAATCTTACGACGAAGCCCTATGGTCTAGGTTTTGTGTGGGA
ACCTAGAGCCATAAGGTGTTCGAGACTTCTACTTACATGTATCCCGGAACCCGCCACGACTGAATTGGTAGACGCGCTTCGTATTTGGGGCAACCGAGAT
GCGAGCTTGCTTCAACCTTGCGATCCCCTGCAGTTTGAGAGGTGTGAGATGTCTCTGTAGCTCTACTCGACAGACAGATTGGCACCGTAATCGTAGACCC
GCCATTCCAGCTGATACTTAAGTACCATTAATCTTGCGTCTGTATCGGTTTGGTGGTCGAAGTATTGTTTACTGCTTCAGCGAAATCAACGCAGTCATTT
GGCCAGATGGACGTTAAGTTACTGTACCGGTACATGTAAAAAGAAATCAAAACTTTCTCGTCGCCAGGCCGCCGCCGTTGAGGTGTGTCATGTGGCACTC
GTTCCTTCCCGCCGGCATGCAACAGCTTGTATCCCAATACTTAAGCAAGGTCGAAGCCTCGTCCGGATGATTAACAATACAGTACATGTAATCTCCTCGT
CGCATCGCTGCGAGAGAGGCGGTTGTGTCACGATCCTGAGCTCGACCCGCTGGAACGCTTGCCTCCAGGTGCTGCGTGTACTGTACTTTAGCTACAGTAC
AGTGTACATGACTGAACAACGACGTCGCGACTGTTACAGAGAACCACACGCACAGATGGCGTATCACGGGCACTGCGAGCTATTGCAGCAGCACCCACCA
GCAACAGCCTCGGACTGCGTGCCGGTGGCATTCCATTCATCACTTCCACATTTGCCCTCCAGCACTCAAGCCACCGACCAGCAGCTCGAAGACTCAAGGG
TAAACCATGGTCAGTTCCGCGTCCAGCGCCATCTTCGCGCTCTGCTCGCTCATCGCCGCCCAGAGCGGCCTCGCTTCCGCCGCTGCGACCCCCGTGGACC
TCGGTTCGTGCCTCACCAAGGCCGGCATCGAGAACTCGGTGCCCAGGACCACGACCTGGACCATGGACATCCAGCCGTGGAACTCGCGCATCAACCCCCA
GCCGGCCGCCGTTGCGTTCCCCAAGACGGAGGCTCAGGTGTCGGCCGCACTCAAGTGCGCCGGCAGTGCCGGCGTCAAGGTGACGACTCTGGGCGGCAAC
CGCTCGTTCTCGAGCATGGGCTTCGGCCGCAACAACGGCGCCCTCGTCATGAACCTCAAGCACATGAAGCACCTCAAGTACGACGCGTCTACCGGTCTGC
TGTCGTACGGCGGTCCCGTCATGATTTCGGAGACTGCCAAGTACATGTGGGGCTTCAAGCGCACGCTGCCCCACGGCCGCTGCCCCGACGTCGGTATGAC
GGGCGTGGCTGCCTCGGGTTTCGGTACCCTCTCGCGTGCCGCTGGTACGGTGCTGGACAACATTGAGGCCGTGCGTGTGGCTCTGGCCAACGGTTCCATC
GTGGACGCCAGCGCCAAGCAGAACTCGGACCTGTTCTGGGGCGTGCGTGGTGCCGCCAGCTCCATGGGCGTGGTGCTCGACTTCAAGATCAAGACCATGG
CGCCTCCGTCGCAGACCGTGACCAACTACACCATCGCCTTCGACAAGAGCGCCAAGCCCACGCAGCAGGACAACGTCAACGCCTTCATCGGCACGCAGAA
GTGGGCCCTGAGCGCTGACAACAACGACCTGCTGTCCATCCGCTTCAGCCTCAAGACCAAGTCGACGCTGCAGGGCTTCTTCTACGGCTCGTCCGCGCAG
GCCAAGACCGTCTTCGCCTCGCTCATGAAGAACCTGCCGCCCTCGATGGTGCTCACGACGACCGAGGAGGACTTCTGGACGTCTGAGACGTACTCGACCC
CCGGCCTCATCGAGCAGACCATGTCTCCGCGCCGCTACTTCTACATCGCATCGGTGACGATCCCCAGCAACAAGCCGCTGACCAACGCCACGGCCTGGGA
CCTCTTCTCCAGCACGGCGTACGCCCCCGCGCTCCCGGACGCTTCGGCTTCGGGCTTTGTTGACATCTGGGGCGGCAGGTACGCTAAGGGTGTTAAGGCG
GACGCATCGGCCTGGAAGCACGACGACCGCCTGCATCTGATCCGCTGGGACATCCGCACCCCGTCCTTCGACGTCAAGTTCGCCGACAGCACCATCACCA
CCATGCGTAGCAATTTCTACAAGTTCGTGAGCTCGTACAAGGCCTCGGGTGGCGTGCCCGGTGGCTTCACGACGTACCGTGACGAGCGCTGGACGATCAA
GGAGATGGCCGAGTACCTGTACGGCGGTGGCAACTTCGCCAAGCTGCAGCAGATCAAGACCAAGTACGACCCCAAGATGATGTTCAACACGGACCCGCAG
GCCATCCCCGCCCTGGCCTAGAGATACCCAGTCGAAAACGTAGCTAACGTTTAGATATTTTTCAACAATGGATGTGTAGTTAGCCCGCCAGACACTTTGG
CTTACTAAGTACTGTGATGAAGGTGATTGCTTGCTGGTCATAACTCGGATCCTTCCTTAGCTCTAAAACAATTGCAGACAGCAATGTAACTACAGTTTCA
GAAAACTCTTATGATCAAAATCAAAAACTATACTACTAGTAATTCGTACCAACCATGATGACCGCTGACCGCACTTGGATTCAAAACGTTTCTACTGCAG
AAGCGTTGGTGGTGTTCTAACACGACCACTTCTTCTCTAGCAATCGTCCCTGAGGTAGAAAGCGTGCGTTGTGAGCCACGATAAGCCCCAGACGCACGCC
CCACATCTTTTCGTCCCATGGCGCCTCCCACGGGATCACGAAGTCGACTGGGACCCCCCCCCCCTTCTCCATGCAGCTCAGCGTAGACGTTCACTAACGG
GGCCACGCGCTTGTTCCACGCTGGAGCTTGATATTTACTCCGAGCTTGTCCAGCTTATCGATATCGCGCCCGCACTGCGGGAAGTAAGACCCCACGCATC
GAGTGTAAGTGAGTGTCTTGCCCAGTGTCTTCGCCCAAGCTTCCCGTGGCCAAGGATCTTAGACGGAACGACAAATTTGTGGCGGACTTTGCCATTCTCG
TACACGTCGACATACACCTCGAGAGCTGGCATAATGGCGCCATTCCACACTGTATCGCTATGGTCCCACACAAAGCCAAGAGAGTCCAGCACGTGCTTAT
CCTTATCTCGAGCCACTTGCTTCGCGTAGCTTCTGCGGTATCGAATTTCACGAACAGCACTTCCAAGTTTCATTCCCCAGGCCTCCTCCGGCCATGGTGG
ACGGAACAGCACGATTCATCCTCGTTTGGGACAACGAAATGATGCGGGACGTCCGCGTTACCGTACACCTTCCAATATTGACGCAGCGCCGGCAGAATGA
CTGTGTCCCATTTCAACTGAGACACGTTCGTCACGAAGCCCAGCGCCTTGAGCTCCTCCTCCATCCCAAGGGGAAGACTCGACTTGTTGTTTCCCATCTT
TTACCCGAAGAGCCCTCACTGCATCCCCCAAATTGTAGTCCCACGTCACGGAGGGCCAGCTCTTGCGGAACAACGAAAGTTTGAGGCACTAGCAAGCCCC
CTTTCAAGTGGCTATACGTACGTTGGCGAGGTAGACATCGCCCCTATTTTCGACATTTTCGACACCAGGCAGATATATATTTGTGTCGAAATGTCAAATT
GCTCATTTATACCCCCCCCCCAT