Description :
From Genome Similarity Track
Location :
Scaffold_293:6710- 9674
Sequence
2964 bases(100 bases per row)
TTGATGGAGTGACAGGTCACGTGGATGATGAAGTCGGCCTTGCGGTCCTCCCATCGTTAACTGCTCTGTTGTAGCTAGCCGAAATTTCTGTAGACGAGTT
CATTCAGGCCTTGAAGGCAGGCGACTTATCCGATATGGTGGTCCATAGACCCGATAATGAGTTAAACTCCTCGTCTCTATTGGATGAGACGGTCCTTGAA
AGTACAAAGGCGGCACTTAATGCACGTAGTGGGTCATACTTTTCAAAGGATTCTTCAGATCCTACTACCCTATGGTTAAGGAGTTTCAAGACGTGGTATT
TCATAATCCACCGCCTATTCAACCTCTTAAAAGGGGTGCGTGTCATGAAATTACTTGTTTCCTAAAATAAGATACTGTGTTACACGACAGTGGCCTTTTC
CAAAGGACGTCATTGAAGATTTTTCCATGCTAAGCACACGGCTGGAATGTTACATGAAAGTAAGTCTCCTCATTCCACACCGACATTTTGTGTCAAAAAG
CCTAATGGTAAGTGGCGCATTGTGCATGCTTATAATAAGCTTAATGCTGCCACTATCCCGGCTCATACACCAATCCCCAAAAAGGATGTTCTTCAGAACA
ATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGTGATACCCCGCTCACAGCGGTTAGTTT
TCCAAGCGGTATGCTTAGGGAATGGATGGGTATGCCCCAGGAGCTTTCCAATGCCCCCGCCATATTTTATCTTCTGGTAACTCAACTGTTCCGCCCTCAC
CGTGCTTATGCAAAACGTATTTTGATGACATATTTGCTCATAGCCGTGCTGAACAGGTTCATTCAGAAGTGGATAACCACATCGACCACTTACGGGCTGT
TCTTGAGTGCATGCGCACGAATAATCTGTACGCTAATGCGTCAAAAACATCTACAATGCGGACGAGATTCCATTTTTGGGGTGCTTCATGGGGAAGCGAG
GCCTTCAAGCGGATCCTGCAAAAGTGAAGGCCATAGTGGATTCGCCTGTTCCTCAGAAACAAAAGGATCTGCAAGTGGTTTGGCCTTGCCAATTACTTGC
ACAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCATTGTACAATCTTCTTTAAGAGAATGTGGGGTGGTGCTGGACTAGCACCGAAGATGAGGATTC
AAGGCCGTAAAAGAGAGTCTCCTAAATGCCACAATTTTGGATATACCAGACCCTGATCGACTTTTCAATGTCGTCTGTGACGCTTCTGATTTTGCCATTG
GCTGTGCTCTGTTACTAACAAATGTTGAGGGACGCGAGCGTGTCGTCGCTTTTGAATCCCGCCAGCTCAAATCTGCCAAAAAGAACTATCCAGTTCATGA
CAAGGAGCTACTTCTACGAAGTATGCTCTTGTCAAATTCAGAGTTCATCTGCTTAGCTCTAAGACTTTTGTAGTCTATAACCATCATGCGTCTTACGCAA
GGCGACTCAATCGCCTCACCTCTCACAGAGTACGGCCCGTTGGCTTTCATTCTTTGCAGAATACAACTTCGAGGTGATGTATAAGCCGGGGAGACAAATA
CTTTGGCTGATTCAATGTCACGCTGGCCTAGTTTTAAGCTTGCTCATGTTACGATTCTATCGTCTTCATTTACTAACTTAATCCGTGTGTCTTATGACAA
GAAGGAACAATGTGTAGCTTTGTTACGAGCACTCGGAATCATTGAGTTTAAGGACTCGGACATTCAATTTATGGCACGATCGCGTGCGGTGCTACATCGA
TATTCTATCGAAAATGGCATGTTGTGCTACTGCACGGATGCTGCAGAAACCCCACGCATCTTTGTTCCTCATTATGAAGAACTTAAGCATAGCATTCTCT
CTGAAGTCCACTACACAGCGATAGGCGGTCATCTCGGTCGTACGAAGACCTACGGCGTAGTTAGCCAGCGTTATTGGTGGCCCAGACTCTCTGAATGGGT
AAGCACTTATGTACGCAAATTTGAGACTTACTAACCGGGAAAACCGTCAGCACATGCGGCTGCGCCGCTGGATAGTTTGCCTGTCCTCTATGCGTGTTGG
GATTCCATCAGTATGGACTTTGTATTTGGCCTACAGGAGGATTCGGACGGCAACACGAGTATTGTGGTCTTTGCCGACCGTTTGAGCAAGATGGCTCACT
TAGCGGCTGTGCCAGACTCCAGTGATAGTGAAACTAAATCTTCGCTGTTCATTGATCGTGAGTTTCGACACACGGTCTGCCGCTGGAAATTGGCTCGGAC
AGGGATCCTCGTTTCACGGGTATAGTTTGGAAGTTCATCTTCACGGTGATAGGCACCAGATTAGACATGTCTACTGCGGATCATCCGAAGACCGATGGTC
AGACTGAGCGCTTAATCGCTTCCTCAAAGATATCCTACGCAGCGTGTGCGCTGATACGCCTTGGCGTTGGACATCAGTGCTCCCCATCGTTGAGTTCGCC
ATGAACAATGCCGTCCATGCCTCGACCGTCTATACTCCGCTCTACGTGAACGGCCTCACACAACCCCGTGTGCGTTAACGTTACCAATACGTAGTTTAGG
GATTAGAGTGGAGGAGGTGGCCTATCGACTTGCTGATGTTATCCCTGCTACTGTTCAAAAACAGATTCGCGCTTACCTTACAACGCATTTGAATGTCTTA
AGACACCTGTGCGACGCAATGGCTGATAGCCATGACAAACAGAAGGAACAAGCAGATGTTAAAGGCAGAAGCTGTATTGAAAGTTATGAGGTATGTGACC
AAGTATTACTGAACGCTATGAATATATCTACATATGTGGTGTCTGCAGTGTTTAAGACGAAGCTGCGTCCTCGCTTCATAGGACCATTTACGGTCGTAGC
CAAAACAAGCCTCGCGTATACGCTCAACTTCCCGTGAAAATTGCGCACCCCCCCGTGTTTTGCG