Description :
From Genome Similarity Track
Location :
Scaffold_764:6710- 8636
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_764-snap-gene-0.3Histone acetyltransferase

Sequence
1926 bases(100 bases per row)
TGTTGACAAAGCTCATGGAAAGCGAGTTTGGCTGGGTGTTTAATAACCCGGTCGATCCCGTGCAGTGGAACATTCCCGATTATTTTGACGTCATCAAGTG
TCCCATGGATCTCGGCACGATCAAGAAGCGTCTCGAGAACGAACACTATAACAGCGTCGAGACGTTTTCGTCGGACGTGCGGCTCGTTTTTGAGAACTGC
ATCGCGTACAACAGCAGCACCAACAACTTCAACGTGGCGGCCAAGCAATTGCTCGCATCATTCGACAAGCAGCTCGGGGCGCTCAAAAGCCAGCTCGAGA
AACAGTTATTCAAGCGATGCGAACTGCGCAAAGAAGAAATGTGCCAACTGTGCGGCGGCGACTCGTTCAAGTTTGCGCCGTGTATGCTGTTTTGCAGTGG
TCCGTGCACGGGCCGCATCCGTCGCCACACGCATTACTATAGTGATCCACGCGGTGAGCACCATTGGTGCTCGAGCTGCTACAAGCAAATGAAGGACGGA
CCGATCGACATGTCGCTGCTGCCACAATTGTCGGGGCCCCCGCCAGAAGGAGGTGGCGCTGAAGTGGCGCTTGCCAAGTCGTCGTTGCTCAAGCGCAAAA
ACAGCGAAGTTGCGGAAGAACCGTGGGTTGAGTGCGACTCGTGTAAGCTCTGGTATCACCAGATCTGCGCACTGTTTAACGAGCGGAATCACGCGATTTC
CGGCGAGCAAGAGCCATTCGTGTGTCCGATTTGCGTCAAGAAGCAGCGCGAAAAAGGGATTAAGCCGAATCTTGAGAACGGACTCAAGGCCAAGCGGTTA
CCGATCACACGTATGGCCAAGTTGATTGAAGAACGCGTGCTCAAGTCGATCCGGCAGGCCCAAGAAGAAGAGGCCACGCGCATGGGCAATCTGGGCAACG
CGGATAGCATTGGTTTTAAGGCTGTGGGCGAAGAGCCCAAGTCCGAGACGCAGTTTGGCGTCACGATCCGCGAAGTGTTGAGTGTCGACAAGCAAGTGCA
GATCAAACCCAAGATGGGCAAGATCTTGGCCGAGCACTACGGCAAACCCAAGAAAAGTGACGTCAAGGCGAGCAATGGAACCCCGGAAAAGGCCAAGTCG
CTTAAGCGGCAGCGATTGGAGTCCAAGAAGAAGAAGAAGGTTACGGCCGACGCGACTGCCGCCAACGGCAACACACTCCAGTTGACGTACCGCTCGCGGT
GTATATGTGTGTTTCAAGAACTCGACGGCGTCGATGTGCTGATCTTCACGCTGTATGTGCAAGAGTACAGCCCTGACTCGCTTGCGCCAAATGCCGGCCG
CGTCTACGTGTCGTACTTGGACTCGGTGAATTATTTTCAGCCCAAGAAGTTACGGACGTTGATGCACCAGCAGGTCATGCTAGGCTTTCTCGAGGACTGC
CGCGACCGCGGCTTCCATACATGCCACATCTGGTCGTGCCCTCCGCTCAAGGGAGACGATTATATTTTCTTTTGCAAACCGGAAAACCAAAAGATCCCCA
AGGCCGCGCGGCTGCGCTCGTGGTACCAGAAGCTGCTGCAAGAAGCCAAGAAAGAAGGCCTCGTGACAACCATTTCCAATTTGTATGCCGAGTATTATAT
GAAGAAGAAGCCGGCCCATGAGCTGCCTTATTTCGAAGGCGACTATTGGCCGCGGCTCGCGGAAGATTTGATCAAGCAACTCGAAGAAAAGGGCACAACT
GGGCCGCGGGAGAAGGCGGCGACGGCGTCGACCGCAGCGGGCGGGGCATCGAACGCCGGGACGGATACCGTTTCGGCCTCGGTCTCCAATGTGGGCGATG
AAGGGAACGACAATGAGGACGACGATGGCGAGGGCGGTGGAGGTGACGAGGACGAGGACATGAAGACAACCATGGCTATGTCGCCGGAAGCCGGGGACGA
CCAGAACGGTGAAGAGGCAGCCAACG