Description :
From Genome Similarity Track
Location :
Scaffold_1246:671- 3100
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1246-snap-gene-0.7Pre-mRNA polyadenylation factor
Pytul_var.sporangiiferummaker-pug3_contig_1246-snap-gene-0.560S ribosomal protein L21-1

Sequence
2429 bases(100 bases per row)
CCCGCCAGGAATGCTCGTCGAACCCGTAGTTGAAATAGTCCGAAATATCGACTCCAGGTTTCCGCCACGGCTTGTCTTCTAGCATATCAATGTCCACATC
GAACGCCGTGCGACGCCCGCCAAACATCGCCAGGTCATCGATGCCGTCTGCATCGCCCTAGAAAATGGCAAAAAAGCACATTACCCCTCATAACACGTGG
CGCAACATGCTTTTAACCGCATTCCAACTATGACGTACCTCGCCCTGCTTGTGGTGCAGATGCGATGCGCCAGCGGGGACATGCTGCGGTCCGCCAACAA
AACTGCCACGAACATAGCGATTCGCGCCACCTAATGCAACAAAAGAGAGAGCAAACCATTCGGCTCGTTCTATTAGTAATTCTATCAAGACACGCTTGTA
GTCCACAGTCGACAACAGTACCTCCTGTGAAGCGCAGTGTGGGTTTGCTGCCTTTCGAGTCGTTGTTGAGCACGATCGCAATGTCTTCTTCGTCCTCATC
CTCGTCAAAATCGTCGTCACCATCTTTGCCTCCACCTGCTGCGCGCTATTCAAACGTCCCCATAACCTCCACTGTTTAGTACATGCATTGAGCTTCTACC
ATAGCTACTATTGCAGAAGCACAAACTCACCACAGCTGGCCCACCGCTGTTAGGAGGCGCCATTTTGGCGCTCTTCTCCGGCTCCGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCTTGATCGACACCCCGCCGTAGAGCTCTTCGTCATCGTCGTCGTTGTCGCCCGCACTCGTAGCGGCAGCAGTAGCGCTGCCTGA
GTCCTTCCACGCTTCCGTCGCCGATGCCGCGGCCTCGCGCGCCGTTTCCTTTGCCGTCACCAGCACGTCTTCGCCGAACTCTTCATCCTAAGCGTACATA
TAAAGAATAAGTATTAGCGCTATATACACAGAGCACATATACACATGGAGAGCGCGCGCATAAGCCTCACCTCCATTTTGGCTCGGGCCAGGACGGTCGG
ATCGCTCTATGGGGGAAACCATTTCTGCGAGGATGTACTTTATACATCTCACTAAGTACGAAAACCCATTCCCAAACCTGGGTCTCACGGGTTTGACCTT
GGTCAATTAGACGGGTTCTTGCTGCTTGTGTAGGGGAAAAGTTTGGACCCGACCCGTTTGGCGCTTTGGTTGCTGGAAGGGGACGGGAGGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTAACTTGGTGTTTGTATGCTGACGCCTTCGCGGCCAATAGTTTTCGCTGTTGGCCGAGCTGCTCCGGTTCCGC
GGCGTGTGCGGGGAAAACCAGTTCTTGTCTCGTTCAGATCTGCAGGTAAGCGGACGCTCGGCGCCTCTCGTGGGCGGAATGGAGTGGGCGGTGACCGGTG
GCTCTGCTGATGCGGCGGGCGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGTGTGGCGAGTAGCATACGCTTTGAAATGAAAATGGCGC
GGCGACAACGAACAGTGGACGAGAGAGAGACAATACATCGAGTATCAGTGTATACCCACTGGTTTCGAATGACGCAGACGATCAACCTAACGCACAAATA
AATGCAGACAACTGGGAGCTTTATGGGATTGCGATCTGCATGGCGATATACAGGAACACGGAGATATGAACAGCAAACCGGGATCGATGGTACTCAATAA
CGAGTCTGGAGCAAACCGACAGTACCCCACAGCAATCAGCGAGCAAACCGCAGTCGCCCTTCCTCCTAAAACGCCACAAATGCGCTTGCAAGATGATGAC
GGATAACAGACACTAATAGGTCGTGTGTGCTTCTGCAGGAGAAACTAATCAAAAATGCCGCACTCTTTCGGTTACCGTGCGCGTACGCGCGACATGTTCG
CTCGCCCATTCCGCCAAAGCGGTATGATCAAGCTCTCGACGTACATGCGTACGTTCAAGGTCGGTGACTACGTGGACATCAAGGCCAACGGTGCTATCCA
CAAGGGTATGCCACACAAGTTCTACCATGGTCGCACTGGCCGTGTGTACAACATCACCAAGCGCGCTGTCGGTGTCCGTGTGAACAAGATTGTGGGTAAC
CGCATCATCCACAAGCACATCAACGTGCGCATTGAGCACGTGCACCAGTCCAAGTGCCGTCAAGGTTTCCTTACCCGTGTCAAGGAGAACGAATTGAAGA
AGAAGGAAGCCGCTGCCACCGGCNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCTTATGATTTCCTACTGAATGGCTCCGTTCCTGATCTCTAATCTATTG
CTCATTGCCTGAACAGTCCGCGCTGTCATCAAGCGTCAGCCTACCCCACCAAAGGAGGCCTATACCTTGAAGACCAAGGGTGCTCTTCCAATCACCATGG
CTCCACAGCCTTTCGTCGACCTTATGTAA