Description :
From Genome Similarity Track
Location :
Scaffold_2781:671- 1737
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2781-snap-gene-0.33-hydroxyisobutyrate dehydrogenase

Sequence
1066 bases(100 bases per row)
GCGTCGGATGGGTGGGCACTGGCATCATGGGCAACAGTATGTGTGGCCACATTTTGGTACGTGTTTCCTGCTCTGATGTTGTTGATATGGAGCTTGTACC
TGGCCTCGCATTCTCACTAATAAACGCTTGCTAACTTATTACAGAGCCAAGGCTACGAAGTGACGATCTACAACCGCTCGCCAGAGAAATGCCAGATCCT
CCGCGAGAAAGGAGCGGTCGTGGTCGACTCGCCAGCCGAGGTTGCGCGGTATTCCGGTGCGTTTTCTTGCAGTGAAAAGGAGGCAAAAGCGAGGGAGTGG
GAGCCCTAACACATACTTGTTTGCTCTCTGTCTCTCCCATAGACATTGTGTTCGTGATCGTCGGATATCCTAGCGACGTGCGCTCAGTGATCATGGACCC
AGAGACTGGACTTCTCTCGCGCATGAAGGTCGGCGGCGTGATCGTGGACATGACGACGAGCGAGCCGTCGCTTGCCAAGGAGATCTACGAGGCTGCCAAG
GAGAAGGGCGTCTCAACTCTGGACGCGCCTGTGTCCGGTGGTGACGTCGGCGCGCGTGAGGCCACGCTATCGATCATGGTCGGCGGCGACGTTGACGCTG
TGTACGCCGCGATGCCGTTCTTCAACATGATGGGCAAAAACATCCGCCACATGGGCGGCGCCGGCGCGGGCCAGCACACGAAGATGGTGAACCAGATCCT
GATCTCGACCAACATGATCGGTGTCGTCGAGGGTCTGCTATACGCGAAGAAGGCCGGGCTCGACATGCACGAAGCCATCAACGCGGTGAGCGCCGGAGCC
GCTGGGTCCTGGTCGATCAGCAACATGGGTCCGCGCATCGCGAAGCGCAACTTTGACCCAGGTTTCTTCGTCGAGCACTTCCTCAAGGACATGGGCATCG
CGCTCAAGGAGGCCGAGAGGTTTGTTTTTTGCTACGCAGTTGATGTTGTGCTGCTATGGTTTGGACAATGTTGTTGACTGTAAATTATGAACCTGTGATG
CAGAATGAACCTCGCGCTTCCTGGTCTGGCGCTCGCGAACCAGCTCTACATCGCCGTGAAGGCGCA