Description :
From Genome Similarity Track
Location :
Scaffold_13:670844- 672553
Sequence
1709 bases(100 bases per row)
ATCGACCCGCTAGTTGTGCAGGAAGAACGGCGCAGGCGCATTGGCACAGCCCAGGATGAGGAGTTCCGGTGGTCAAACCTCATAACGCTGCTAAAGGGAG
ACGAAGCGAAGCTTACCTACAAAGCTGCACGCGAAGCCTGGAAGATGGCTGACAAGTTCGTCTTAAGCGAAGATGGCTTGCTGTATTTCCTTGGTGCGAA
TCGTCGGTGGGGTCGCGACCGGGCCGAGGAGACGACACTACGCCTAGTCGTGCCAACAACGATGGTTCAGGAGATCCTACAGAACTGCCACGACTCGTTG
GAGGGCGGTCACCAAGGTATCGTCCGAACCTACCACCGAGTCAAGGCTGACTACTATTGGATTGGCTTATTCGCCGATGTGGAGAAACACGTACGCTCGT
GTCCAGACTGTAGCTGAAGCAAGAGTCGCCCGCAGCTACGTGGGTACTCCCCAGGCAACATTCTGGCCGAGCGTCCGCTACAAATTGTCTCGATGGATTT
TGTGATACCCCTACCGAAGACTCGGCGGGGCAATACCGCACTGCTACTGTTTCAGTGTGCGTTCACTGGATTCGTCATGGGCAAGGCGATGGCGGACACA
TCTGCACTCTATGTAGCACAAGTATTCGAAGAGTGCGTGTACCGAAGGTTCGGAGCGCCGTCTCTGATCAGGCATGACCGAGACCCGCGCTTCATGAGCG
AGGTCTTCCAAACCTTCGCCGAGATGATGCAGTCGAGATCTAGGGCTACGTTGAGCTATCGGCCTCAGGCTAACCGCCAGCAGGAACGCTCGGTCAAGAC
CGTAATGAAATCGGTGCGAGTGTACGCGGAGGACCCGCTGCAATAAGACTGGGATGAGATTGTGGAGAAGTTGATCTTTGCGATTAACAACTCGCAGGAC
GCCACGAGGAAGGACACGCCCTTTTACTTGGTGCACGAATGGGACGCAAGGTCCACCCTCCGAGCAATGTCCTCATCACTGAAGCGAGGTGTCGGGCGAC
AGTTCGATGCGTTGTCACGGCGCAGAGAAGTCAACAGGCAGCAGGGAGTTGCGTTGGAAATGGCTAAGGAGTACCAAGCAGTCGAGAAAGCTCGGCGTGC
TCAAAAACATAACGAGGCTTTGAGCCGAGCAGAACGTGCTGCGCTTCCACCTTCCGCGACTGGCGAAACCTCGGAAGATGATCCGACAGGTGCAGAGGGT
GACACACCAGACCCCGCACCGAAGTCTCTCTCCCAGCCTGGTGATCGCGCGTGGCTTTAGATGGAGCGCGTCAATCCAGGATTGACCAAGAAGTTGGCTC
ATCGATGGCATGGTCCCTTCCGCATCAAGCAGAAGGTTGACGAGTATGCGTACGAGTTGGATTTGCCTGACCAGAGTGGTTACCGGTTCTACCCTGTAGT
GCATGTGTCCCGGTTGAAGGCGGTGAACGAGTTTGGTGATCGGCCGAAGGCTCGACTTGCTGCCGAAGTAACCGAGGAGACGCGACTGGATTTCGACGAG
GAGTCACTCCCGGAGGATAGTTAGAAACCCGACCACCTGGTAGGCGAGTATGAGGTTGAAGCCATCTTGGATGACCGAATTCCCCTCTCGACGAGCACGG
AGCGAGCCGTCCGAGAGTTCAAGGTGAAGTGGGTCGGCTATGACGAACCCTCGTGGGAGCCCGCGTCGAATCTGTCTTGTGGCGTACTATCTACGCGAGA
AACGACGTG