Description :
From Genome Similarity Track
Location :
Scaffold_16:670800- 673287
Sequence
2487 bases(100 bases per row)
GTCAAATACCACTGCCGAGTTCATCGCAGTAAATGACGGGATCCAGTAGGTCGAGTGGATCCAACGCGTTGTCTCGGAGCTTCTAGGGCAAGCAGATCCA
TAGACAGTAGCGCTTTAAGTTGACAACCAGCCAGCTACTTACATAATCAAGCGAGACAACAGCTCCGGGGCTCAAAAGGCAATCGACATTCGGTTTCACG
CTCTGAAAAAGGCGTTGAAAACATATCACCATGCTTAAGTATGGACAGACGCACGAGAATCCTGCTGACTTGCTGACCAAGGCGCTCAACCAAACGGACT
CCTCCACAAGCGTGATCTATGTTACCTGGGCTCGAATCTGGATGACGGCCTACTGTAGGAGCTGCTACTTGTGTGTGTGTGTGTGGGGGGGGGGTGTTAT
AAATGACGCCCGCATGGGTACATGTACAAGCAGTACAGTTGTGCACCTCCAATTCGGCAGGGCGGACCATATCAACAGTACCAGGGCATAAGTGCACAAC
GTAAAGCAAAAAACAAACGCAAATCCAGTGCACTGATATGTTGTTTGTTAATTCAGTACAAATTTTACATTTAGTTCTGAGACGATGCCTGTGTGGCACC
AACAGTTCCTAATAGTCTTTGCAGATATGTTGTTCCAGCCTTCAGACAACCACTTCATGGCGGAGTAAACGTCGACCGGCGTGTAAGGAACACCCTTGTG
TGGTGTAGGGATTTCCAGATTCGACCATACGCCGACCTACTTTAGGTCAAGAATCGGCTCGGTCTGATAACCCAGAGCTTAGGAGCCAAGGATCACGGTA
AGTACTCGGCGATCTGTCCGGATATGCTATCCGGACAGCCGCTGAGCTCAACGGTCGCCGGAACTCAGCTGAAGGGTCGGTAGAGATCCGAAACGACTAC
ATTTCATTAGATATTTGTATGAGAAGCATAGGATTAAATAGGGGGAGCCGAAAGGGCTCCCAGAAGATAACAGAGCAGAATTTTCCTAGTCCAAGACACG
TGTACACTTTTCCGGTAAGTCCCTGCATAGGGCTGGATTATGCCTGCCGTCAATACTCGAGAGGCATAGCTTGTAGGGTATTGACTGGTAGCGCCAAGAG
ATTAGGTCGGTCCGGGTAGGACAAAGTCTCGCTACGCGCGAAAGAAAGTCCCGCATACTCAGCGGGCCGGTACGTCGGATAGCCCGGGTGCCGTAACACT
TCTAGCTGAGCTGCCTCTGCGCTCGGTGACCTGTAAAAGCGCTCGCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGTGAACGAGCTCAGCCG
AACCAAACTCGGCGGAGCCTCGGAAGTGATCTGACTTGGTTAGTCGGAACCGGGTGGAAGCGAGCCACTCGTCTGTCCCGGAAGGGCCGGACCGCGAGGG
GACCACCCTCTGCGCAGGCCATACAAACCGCCGACCTAACTCGGCGATTCGTTGTGGTTTGTGTAAGGAATCCACATCTGACGATATTTGTGTGTTCTAC
TACACCACAACTTGTGCCGCGACACGGGAACAGGAGTGTGTGCTTGTTTCTTGTTCTGGTACTCATTCTTCAGGCACTTAATGATGCCCTGGTCCATGGG
CTGCAGTACGGCAGTTGTATTAGGCGGGAGCGTGGGGAGTAGCAACATTGGATAGCTCAATAGAAGCGTCGCTGTGCGACGAAGCATTGTCAACAAGTAG
TAGTACTTGTCGTTCTTCCAGCTGCATACGTTTATTTAGTGCCAAGAGCCAATCACAGTATTTTACCGTATTTATCCACGCCTTTGCCGTATTTGTGTAG
GTAGCTCCAATTTCGACTAGAAGGTCGCTATTTTTTTTAGGGGGCGCGGCACTTTAGAAAACCACAGCCCTGTTCGCTGCTGGAAGCGGTACAGCTTGGG
GGGTCTGAAAGCGCTCCGTTGGGTTAACGAGCAAGTTCGAAGTGAGAGCATGCAGGATCTGACTTGTGCTTCTCGCACAAATACTGCTTTTGTGCTAGAG
TTAGGGACATGTAGGAGGAAGGGCGATGTCCCATTGTCTTTGGCGGTAAAAATCAAAGTGTGTGTTTTGTCAGAAGACGTCCCGATCCAAAATTTAAAAT
CAGATCGATGCGGCGTGTCATCCCTCCGCGAGGAGGGGAAAACCGTTGAGGTTAATTGCTAGGGTGGTGATGGGCAAAGGTAATTGCGCATCCGATTCGC
GTAATCATAAAATCTGGCAGGGTATCGACTGATACCAGTGCCAAATTGGAGGTGCACGACTGTACTTCCTGATACAAGTTCAGGACGAGGATGCGTCAGC
AGCGTCTCGTAGGTGATAGCAGCTGATGACAACACTGGTAGTCTGATGACGCAGGGATTATAACCTAATAGAAGTAGACGGATGCAACTAACACCTTAAA
AAACGCCAAGGACAAAGCACATTGCATTCAAGGTTACCATCAAGTTATTTGTGGAGAAAGATTGTGATGGACGTTTTTTAAGAGCAA