Description :
From Genome Similarity Track
Location :
Scaffold_32:670796- 677909
Transcript NameFunction/comments
Phyin_T30-4PITG_14095Putative uncharacterized protein
Phyin_T30-4PITG_14096Putative uncharacterized protein
Phyin_T30-4PITG_14097Putative uncharacterized protein

Sequence
7113 bases(100 bases per row)
TGGGTTTAGCATAGGGCTATAAGGGCCTAGACGTAGCACTTTCAGCTTGTTCACATTCACGGTGCCGTCAGCGACGAGGTAGTCGCGCGCCAAGTTTTCA
ACGTCAGTGTGTGCCGGAGCATTGTCTTTGACAATTTTAACTTTGGCTGACTGCAGCTCTTTGTACTCCTCTGACTGGAGGGCGGTAATGAACAAGTCCG
CCATGAAGCGCGCGTTCTCTTGTTTCTTGACCGAGCCGTCATGAGCTCGAAGTAGGATTAGCCTAGAGCCGCTTGATACGCCGCCTTGCACGTGAAGGTT
TTTTCCTTGTGATGGTGGCAACTTGACGACAGCACGCTGACCAATGCGGGACCAACATTCATTCCTCGATAATATAAATTAAAATTAGTCTCATCTTGAA
ACACCACCATATTACCTTTTTAATGTGCTTGTTTAGCTCTAAGACAAACGTCTTGCACTTCTCCTTGTTGATGGTCGAGTTCATCGTCGCCTTCTCGATG
CGTGCGCGCTTCGTAGAGTAAAGTATACCCTGTAGCGCCCAGTGAACCGACGTCTTACTGACGATAACACCTTAGTCGGCGTGGATTCTGTCGCACAGCT
GCTCCAGTGTCATGCGGCAGTCCTCGTCGATCAGCTCCTCGATCGTACTCATAACGTCTACCGTCATCTTGACAGACGACTGTCGTAAGCCGCCGCGCTG
CTTAAGCTCTTGGCCAGCCGCAAGAATGGCGCGCCGCACGGTAAAGTAGTTGACGTCGTTGGCAGTAGCTACCTCTCTCCGATTCTTGCCGTCTTGGAAG
GCACGCACGACTCTAGCCTTTGCTTGGGCTCGCTCGAAGGAAACGTTGGTCTTGGAAGGTTATTGAGTGGACGGCATTTCGATAATGGAGGGGGAATGAG
CAGGAGTTGGGCTGCGCAAATTCCGTTTTGCAAAATATGAAAAATCCCTTTTTGTGCAAATGCCCAAAAAGCCTTTCTAACACACTTTGCACCTTGGATG
GTAAAATTTGGGACTTGATTGGGAAATGGTGTATGTTTTTGCAAGCTCGTTCCCTTGATGAATTCTGATAAACGGGGAAGGGTCAAGCTTTTCGTTAGGG
TTTCGGAAGGCGCCCAATTATTATTAACATCCAAGTTCACAATAAAAAGCTACATTTTAAAAATACGGGGGCCGTAGCATTGCCGTTTTGCCAAGGTGAA
TTGAAAATGAGGCTTTAGTACATGTACTTGATCTCAGATTTCGAGATCAAGGGTCAATTTTAACCAATACGTATAGCATGTACTTCAAAGTACTCATTAG
ATAAATCATGGATTAACTGCACTCGCTACTCCTTGTAGCTAGCATACCATTTGCGCAGTGGCAGCGGCACCGACAACAAATTGTGTCTCGTTAGACGGGT
CGTCTTCGGTGCAAGTTGTGGGCAACCTTTCGTCGCGCTGAATAACTCTGCGAAGTCCGACCTTAGAAGCACATTTCCGAAAGTTGGAGTGCAAGCACGC
AAGGCGAAGTCGTCGCTTTCGCTCTCAATGAGCCAGCAATCTTCCATGTCGCTTGAGTAGTAGTCGAAGTCTTCATTCTTTGAAATGGTATACTTCTCTC
CATTGAACACTACACTCACCTCGCCCTTGTCTTCATCAGAAACCCACTTTGCTGTCGCCAAGACTGAATCGATCCCATCCCACGCTTTACTTTGGTTTGT
AGCCAGACAGCCACTCGTGACGATGCTGTCTCCCAAGCCCAACGAGGTCTCAACCCATTTGTAGCCTCTTCCATTTGCCAACGCTACATACTGTCGACTC
GAGAGCACCAGACCCGAATCGATGGACACCAACCCGTCAAAAGGCAGCGAGGTCTCGCTCTCGTTTAGCGGGAAGAGGACGCCCGTCAAGCTCACATTAC
TGCTGCCTCCTTCGACGTACAGATCACTTGCGTTTCGCGTCTGCTTCAACCACCCACCCAACTTCTTCTGAGGTGCAGTGAGACCTTTGTCACTCGTCAA
TGATGAATGCGTCGTCGAGAATATCGGATCTTCTTCAGCAACTGCAACTCCATGCTGACCAGTATCGTCGCGATCCAGAGCAAGCACCAGTCCAACGGCG
ACCAAGACCAGACCCACTAACACTATAAACGGGGCCCAAGAGAAGCGATTGCGTAGCGGTTGCTTCTCGTCGTCGTGGTCGTAAGTCGAGTCGAGCGACA
CCGTGCTCAACGGCGCCACTCGCTTCGGCTGCTCCTGTACCTCACCTTCACCGTCCATATTGGTAAATGGGAGCGGATAGAGTTCGATTCAAACAGCACA
TGTAGAGTCTAACGGAGAAGGGAGCGCACGACACCATCGCAGCATCCCAAGCAGGACAGAACAACCTAACTGTCGACGACAGTCTGTACAGCGAGTTGTA
CGATAAAGAAGGAGAATATTTAAACAAATTAAACAGGCAAGTTTACGTTAAAATAGGTTTTGTCTTGGCATCAAAAAATTCAGATCCGGAATACGGCCGG
ATCACGTTGAAGGGCGGAAGCGCATCCCACTCGCATTTCGCATTGTTACACTACGTTACTTGCACTTGTTCACCTTGTCATCTCTCTGCACGCCGCATGA
ATCCTCTCTCTTCTTGCAAGCATCGATGTGTGGACCAAAGCACCGTCTCGGCTGAATCGAGCAAACTTCACCCGAAGTCATGGGCGCCTGAAGATACTCG
CACTGCTCGAGCTGTCCAAACGGTTCAACCGGTGACTCTGCCGAGTCCGACAGCACCGTGAGCTCCAACGCTGATCGCTTGCCGTGGATCACCAGCACCG
GATCTGTCGGCTGGTTCTCGGCGCTGTCATCCGCATCAGGATTTGACAGTGCAGTCGTCATCGTCCTCGCCCGAAGCCAATCCTCAGCACAGACCACGAA
CGGCGTGTCAAAAAACGTGAACTGTAGCGGCTTGCAATGTACGTCGAATTCCGAGTATAGCTCCGGTCGGAACGCGCTGTGTACAGTGTCCTTTAGTGCA
TGCAGCGGTGGGATGTCCCGCGTCGTTAAACACGTTGCGCTCGCGTTGCTTGTGCTTAACGAGCGGCGATATCCGCGATGATTTCTCAGTACGAACAGCT
CGCTCTCATTCGCGGTAGTCACCACCATGCGTCCATCGAAATGAAGTCTGTGCGAGCACTCCGAGAGACGAGGCCGTAGACTTCCGGTGACATTGAGTCG
CTCCGTAGCACTCGCAGTCGTCTGCAGCGTCAGGTTAAACGAGATTGCTGAAGCGTTTTCCAGCGCGAAAAAAACTGCAGAAGCTTGACGACGAGCTGTC
GACATGGACGTCACGGCCACCCACAGACACATGAGCACATTGATCGCCACAAACGCCGCGAGCCCTAAGCACATGGAGTCGCGTGCTGTCCACCGCGGCT
TCGACACTACAGAAGAAAGCTCCGTCATTGGCACTTTTTTCTCAATGTACAACAACGTTTTCCTAATTATTATCGAACGCCTAACTAACTTTTTTCCTAC
AACAAACGCTAACTCATAATATAACTAGCAACGGGCTCCTGGGACCAGACAGTAGAGCTGCGTCCTCCCTTCCCACAACGCTGAACTCCTTAGCCCAGAG
TGATAAGCGGCCCCACCACCAGGTTCTCCCACCTCAAGGCTAGTACCAGCACTTCTCGCATCCAGAACGCAGCGTCGGCCGACGTGGCCGAGCCCAATGA
GCCTCCGTACTCGACTTCAAAGCCGCGGATCCGATGGCCTTTCTCCTCCGGAAGCGTCGTGAACTTCCACCAAATGAACGCCTTGGACCAGATGACGCAC
TGCGACGGCGGCGTGGCTGCACCCGACATGATGTTTAAATCATTCGCGTCTTCCGGATTCATATCCCGGATACACACGAGGTGTCCATCCGGGGTCTTGG
TTCGGAACAAGAGGTAAATAGTGTGGTGCACCCACCCATCGACGGTGTGTTTGATCTTGCGACGCACTACCACCACGTCGTTCTCGAAGCGCTGTAGCAC
TTCGACTTTGACCTCCAGACTGAGGCCGAAGTAGCGCGTCACCTGGTCCTGGACGGCGCGCATCTCCCAGCTACGCGCAGCCAGGTCTTCGCTGCAATCT
TTGGCGAATTTCTTGTGGAACATGAAGTTCACGTTGTTGCCCACCAGTTTGCGCTTCTCGCGCCAGCCGCAGATCTCGAGGCCGCTTGTGACAAAGTCCT
CGCTGTTGGAGAAGGCCTCGATCTCGAGGAACGAGTCGCGCATGAGGCGCAGACACGTGGCTTCTTCCATAGGACGCCACGATCGCGGCGTGTGCAGGTC
GAAGAGCTCGTCGGCGACCGAGTCCGAAGTCGTCTCGCGCTGTGTTTTAAACAAACGTTTAAGACAATCAATAAGAAGTCGTATCCAGTGTTTTAAACAC
CAACACTCGTTCACGTACATGGTCGTACTCGAGCTGCAGCATCGAGTGGAAGAAGCGGTGGTCGTCCAGAGCCTTGCGGAGACTATAGTTGTGGTTCGTG
AGGTGCGTGGCCTCCATCGTGAGCTCCGAGATCTTCTGGCGGGTAGGGCTCTCGGACTTGACGCCTTCGCACAGCTCCCGGATGCGGCTCTCCATGGCCG
CCACCGTCTCCTTCATCGTCATCATCGTGTACTACGCAAAATGTCAAAACGCAGCGTCAAGAGACGTCGACAGCGGACACCACCGGAAAGAAACACAGAC
ATGTCAGTCCACTTGACACACAATGATAACTCATGTTAGCAGCTGCAGACTCACCTCTCGCTTGTGACGACTGCGACGCTCGTAGCTGCGTAGACGCGCC
TTGGCTTCATTTGGCGGCGGACGCTTGGGCTTCTTCTCCTTAGCCTTGGCGGAGGGTTTGCGGCCTCGACGCTTCTTCTCCGTCGTAGAGGGCGGCACTA
GAGCGTTGCGAAGGCCAAGTGGAGGCAGCGGCGCTACCGAGGACGACGGGAAGAGCGCGTCGGCGTGCATGGACGCCTCGGGCTCCATCATCATCGTCAT
GACCTCGTCCGGTCCGCTCTCGGACAGCTCGCCACACACCAGATCTTCGTCCAGTTGGTCCATGGCCTCGTCCTGCTCCGGGTCCTGTTCATGCGGACTT
GGAGCTGACGACGGCTCACCCAACGCGGCGCTCCAGAGCGAGTCCAGCTCGTCCTGTTCCTGGTCCCTGGGGCTACCCTGCTCGTCCTCAGACAATGTAC
CTGGAAGCATGATGGCCATCACGGCGGCATCTGCATTGTGCTCCAGCTGTTCGAGTCCCAGCTCGCCCAGCTCCTCGTCGCTCAGCATCAGGCCACTGAG
CTCCGTGTCCGTCGATGGCGCGTGGTGCAGAGCCTGCATCAAGTCCAACATTCTTCCTGTGTCCCTGCTAAGTACGCTTTCTTTTTTTTGGACGCAATGT
GTGCGAGCCGATGCAAATCAGACTATGGGTCGGGACAAGAGCTGAGCTGTTCACGTCTGCATCGCTCATGTCATAGTGGGCTTCAGTGAAGTGGAAAAGG
GAGGGGAACCGGAACGGGTTCACTTGTTTTGACTATGTCTCTTTTTGCGACTGTACCGGTACTTCGCTGCCCAAGTTCAACTTATAAGCAAGCTCACGTT
TAACTTGTCATTGAGAGGGCAAGGGAGATGTCCAGCCGGCAGGAGCTTGAGGACGGTAATAATCCTGTATCAGCCGTTTGTGCCGGTGCGGCAGTCTCCT
TCCCAGCGTTTCGACGGTCTTGATGGTATTAATTCAGTACTCTGTACATGTCGCTTGGTGATGGTCACACAGTCCCTTTTCTTCTTCAATCGAGCTCGAA
ATGATCGGTACAGTGTACCACTCTGGCAAAAAAGCAAGTGACGATGGACGTCAGTCGAAATTCAACCAAAGGCGTATCTTTACAGCAGGACAATTCGATT
ACACCTTCATGCAAGACGTTCCTCTTATGTAACTCGCACATGGCCTTCGTCGTTTGTCCACAGTAACTGGTTGCTTATGGCAGCACTGCCAGCAGGTGCG
CTCGAAAGAGAATCCGACAGGGCCGCCGAAAAATAAACGGCACTTACAGTAATGGTCATAAATATTATCACATTAGGTATTTATGAGTCGTGAAAAGTAG
TAGATCATAATTTATGCCACCAAGGTACTATTTTTATGCATAATTTATGAGAAGGTACACTTCTTACTTAGGTTAGTATACGGAAAAGCTTACCTTCGGT
TAGCCTCTCCGAACCAATCATATATTCAAACATCTATCCGACACACTGCCTCCTCACTTTCCAATTTTCTACTTCTCCTACAAGCTCTACACCTCATGCT
AGCTACGCCTCGTCCCCGGTCAACTTTCTCCAACGCCCAGATTGTGGCGTACTTCTACTCACCGTGCCGTGACCAGTACGATGAGCTTGTGCCGGAGTAC
TTTCGCTGCCGCTGCGGTAAGGTACGCAAGCAGACGAGCCGAAATGGCTACACCAATCTCATGCAGCATGTGCGCAGCGAGCATCCAACCTTCCAAGAAG
AGATGCTCGCAGCCACAACCGCTCAAACCGGTTCGGTGGTGCACTATGCTCGCCGCACGGCCGTGAGCCGGTTCGGCTGGCTTGAGTGGATTGTAGAGGC
AAATCTGCCTCTCATGTTCTGTGAGAACCCTCTCGCTCGCCGGTATGAATTACTATTACTACTCTATAATAATGGTTATACTAATATGAATATGCTTGAT
TAGGTACACTTCTTTGGACCTATCTCAGTGGAAACATTGCGTGCGCTGCTCGAAGGCGTCACTCGCTCCGTTGAAGCAGCTATTGCGGCAGAGCTACCGG
ATGCTTTTGGCTTCATGTTCGATGGGTGGACCCACTCATCCGAACATTACGTCGCAGTTTTTGCGTTCTATGAGCTCGATGGCGTTGCTAAGACGGCGCT
TCTGAGCATGGCCCCGGTGATTAACGAGCCCGACGAGGACTTGTCGGCCCGTACCCACCGCGAGTTTTTGGTGGGAATGTTCGAGCGAGATTATGGTAAG
GATGTAAAATGCTGCAAGTACCTGGTTGGAGACAACTGTTCAGTGAACAGGCGGTTGGCAACCATCATGCAAGTGCCTTTGGTTGGATGCTCTAGTCACC
GACTAAATCGAGC