Description :
From Genome Similarity Track
Location :
Scaffold_166:67077- 69105
Sequence
2028 bases(100 bases per row)
ATAATAGGTTCAGTCCTTCATAGAAGAACCATGAAGGTTTATGTGTACCACTTTATCTTGAGTATACAAGGACGTGGGGCATTTTTATTTTTCAATTATC
TGGGGCAATTATTTTTATTTTCTAATGATCTGGGGCATTTTTTATTTTCGTGATTAAATGGGGCATTTTTTTAAAAGAAAAATGCCCCATGTTCTAGTAT
ACTCAAGTTAGCGTGTCACATATATATAGTCATTGTGCTTCAATGAGAGTTAAACCTATTGCAATCACCATTCGCACACAATATGCTGATACGTCTGACT
ACGAAAACAGATGATCCCTTGAATACGGCCACGCGGATATTTACCTGTGACAGAGTGGACTTATGCTATGCTCGCGTATCAACGCTAAATTCCGTCAATA
CATATCTGCAAAAGGGCATAAGGCTGTAAGCTAGGTGCAGTAGAGAAACCTTAGGTCGAATCGGGTGTGTAGGTCCTTAATATTTAGAAGCACCACTAAT
TAATACCCATGAACCTTTATAAGAATACGCATAGTAGTTCTGTAGCACATCGCAACAACGCAGCACGTGGTTTGGCACCCCAATATGAACTTAAGAGGAC
CGCATGCCAAGTGCCGACGGATACAGTACGACAAAATAATAAAAAATCTTGTTGAAGTCCATACCGTAGGTTTCAATGCAAAGTGTATTTGATTCTTTAA
ACTATGACATATGTGCTGGAGTGATTTAACACTTCGACCAAATCAAACGTCTTGTGTACTAACTCATTACCTCTTGAACTCTTCACGCCCAGCGTGCCGT
TCATGGAGTTTATAGTCGTTAAAAGCACCGGTAGATTCCTGCAATAGCACTTAAATGTCTCTTACAGCACTGGTACTGTTTTCATATTGCTTTGTATCGT
ACCTTCATGTTGGACACAGCTTTGTGCACGCGGCAATCTAAGACGGCACTATCTATCTAAGCCAGAGTAAATGACATGTAGGATTCACATATCTACAGTG
TCAATCCAAAACTTTCGGACGAAACCAATAAAGCAACGTTATCGTACAACAAAATGACAAACAACTTCGATAGACTATACTTGAGGCATCATCGAATCCT
TTCCTGCTTGCAATACGCCTGCAGTCGAACAAGGCTGCAAGCGTTCGAATAAATAAAATAATATTTAAACAGAAAGAAAGGATTTATTATGGTCTATTGA
AATGGATAATTTTGTTAAAGAAACTAGAGCTGATTAGCAGAAAGCAAATTCCTATCCTAAAACTATTACAACACAACAGCATCACTGCAGTACCAACAAC
ACAAAACAGAAAGAACACCAAGAACACTAACAGCGGTAGAAACAACAACAACAGGAGCAGCAGTAACAACATCAACACCAGCAGCAGCCGTAACAATAGC
AACAGGGCTAACAAAAATAACTTACAAGAACAAGAACGGCTACAGCAACATCGGTAGCAGCAACAATGACACTAGCAACAAACAGTATCAACTGAAACAA
AATTGACAATCAGAACATTAGAAAACACAATAACAACAATAACAAAAACGATACCATCAACTACAACAACATCAGCACTGATTGTCCACATATAAGGCCA
CCGCCGCCGATATAAAGACGCGTTCACGTCGTTTCTGTACTGTCTGCGCCCGCGACAGACCCCTTTACGCGGCTCCCCCCACAGGTCGGGGGTTGAGCAC
GGCTGTTCAATGGAAATTGAGAAATTACTAAAGATATGGATGTTTTATGTACCACGTTGACTTAAGTATACTAGGACGTGGGACATATTTTTATTTTCTC
ATTATATGGGGTAAATTTATTGTATTCGTGATTCAATAAGTCATTGTTTTATTTTCTCTTTTCTTTTCATTGACTTCCTGTACAAAAGTGTACGCGATAT
CTCGGTGAAATCACTTTCCAAAGATTGAGTTCTTGGCTAACGAGATATCAACCTACTGAATTTTCTATAAGATTTCTGAGCTATACAGATGCTGCTCCCA
CATTGTTAATAGAGAAATCTATGATTTT