Description :
From Genome Similarity Track
Location :
Scaffold_566:6707- 9315
Sequence
2608 bases(100 bases per row)
AGATGGAGCTCGATCAGTATCGGGACGATCTGGATGATATGGAAGCCGATCACGATCGGTTATCCTCCTTGCTTTCCGATCGGGACGACCAAGTGGTTCG
GCTCTAGACCCAGATCTCGGATCTGGAATCCGAGCGCGATCGCGATACACTTCAAGCAAGTATCAACACCTTCGCTACTAGCCTGGCTATACAGCCTTCG
TCCAGTCCTGACCTTTTGACTCCATCCCTCCCTGGGCCATCAGGCGTGAAGGATGCGACGGCGCCCCCGAGTATCCGCAGCAGGCATCCTGGAACTTCTT
CTCCAGTTTTCCGCCTCCTGAACAAGAGGCCCAACACAGGTGCTTCCCACACTTCCCGTGCTTCCCCACAGTCACGCCGATACCCAAAACTTCTGCTTCG
TCTGTGCCCGATGGCCTCACCACGTTTTCTACTATAATTAAGACCCCCAAGAAAGGTGCTCCCCGTCTATCCCGCAATTCCAAGCGATCTCCAGCAAAGT
CAACGTCTAAGACGTCCGTTTCGTCCGGATCTGGTAGTCGCAAGAGCAAAGGCAAACCGCGATTCCACACTGCCGTGTCTAGCTCGGATGACGATGATGA
TACGTCGGATGCGGGGTCCCAAACGCCGGCTGCACTCTCCCGATCGCGCTCTTCTTCCCGGCGTAGGGTCCAGTCTGGTAGCTCGCTGCCTTCGTACACC
ACTTCGCCAGATTTTAATCGTGGCGGACACCCCAGCCTCCCCGATCACTAACTCTCCCACGCCCAAAACCAAAACTTCCAGGCTGGAATTGTTTGGTGAT
GCTTCTAGCAGTTCGGATAGCGCGATCAGTGTTGCGGAGGAATCTTGAGCCCCAGCCAATACGTTGTTGCCCCCGGCCGAATATGATGCTCTTCCCAAGA
CTAAGGTGCACCGCGATCAGTGGATACCCGAATTTTGCCGTCGCACTCCAAAATATTCGATTCAAGTTTCACCTCAGTCCGCGCGCCGATTGAGCTGGAT
CAGCGTGTCGGAATTGGAATTGGAGTTCTTCTGTCGTCATCTCGCAAGACCCTATCATTACCCCATCCCGGCTCTTCACGTTGTGTCGAAACCACTTTCA
GTGTCGCAGTGGTCCGCTCGCCCGATTTCCTCGGCACAGATCGACACGCTTTACCGCCAGGAACTTTGGAAGTCTCTAAACACAAGATCGCGCACGTGTC
TTTCCAGCCCATTGATGGGGTAAGCAGTTGCTGGATATGTACCACTCCATCATGGATCTCTGTATCCAAACCTTGTGGGAATCGACCGACAGTTTGCCAA
TCTCCTCCGCAGATCAGGTTCGCGATCCAGGGTTGGCTTCACATTGCGATCAGCGGAAGTAACGGCGATCGCGAACTGGCCCCCTCTGGAAAACAGTTAT
CCGATAAATACCTTAGAGTGTGATTGAAGGCCATTGTGACATGGACATTCTGCTGGAGATATAAATATTTAAATCTGATATACAATAAGGGATTGTTCCG
TTATTGTATATCAGATTTAAATAATTATATCTACATTACATGTCTCCTTAAGGTGTAGTCCTGTCAAGCGACATTCAGACCCCAGAGAAAAAGAATGTGA
AATGAAGGCACACAACATCATCAGATACCTCCCTTTTTATTGTACGGAGAAGGTGATAGGAAAAAGTAGGGTAATGATTGGTTTGGCAAGAGTGATCTAA
TCAATTTAATCTGCGTATCTGCTATTTACACTACATTACCACAATTACACCCCTCATAATTTGATGCTGAAAAATAACACAATGACTTTTCGAATTCCGA
CCAATCTACTTCAGTCCACCCAATAAAAAGAAATTGCAATATTTCAAACCCATCATTGGTAATTTTAGACATTGAAGAAGGATCAGTGCCGTTGACTGCC
TGGGAATAGCAGTCGCTGACGATCAGCGTACAGGTGCAACTGTGACTAGAGGACGAAGCGGTGCACTATAAGATCAAAATAACATTCAAAAATTGGCGAG
CAATAACTAATACTCGACCACAATGATGACAACCTGTACGTTGTCAATTACAAGGTTTGCACTCTATTCTACGTCTATAGCATATCAATTGCTTTCGTTG
TATTGAATGGATCTTTACAGATGTATTGGTACAGCACATCTCATGCTAACTTTCAGGAGCGTCCTTATGTCAACATGAAAGGTATCCTAGTAAGATAAAG
ACGAAACAGGTGATTTATATCGTAGCCACATCTGCCGCAAGACTCAGGTCCCACAAAATTAAGAAGTGATTTACTGTACAAGACAGTGTAAATCCATTAA
TAGCTGTGCTTGTCGAACAGTCCATCGTGTAGAAATACGCCTATTGAAACTTAAATCTTGACCTTTCGCACTTAATTTTCCTTAAAACAGCCGTATACAA
GATTAATGTATGCAGTCCATGCTTTTTCTTTCAAAAACGTAGTTCCCTAAATGATGGCAGTCGATGAAATGTCCGCATCATCGCTCCTGTTTGTGTTCTT
TGTGGTTTGTTTAGCCGCTGGAAAATGTATTTCACACATCTCAAGAGCAAGGCTTTACGCTAGAAGGCTGGTGTGTACCTGGATTTTAGAGATAACGACA
CGTTTTTG