Description :
From Genome Similarity Track
Location :
Scaffold_166:67068- 69573
Sequence
2505 bases(100 bases per row)
TTGGTGTTTATAATAGGTTCAGTCCTTCATAGAAGAACCATGAAGGTTTATGTGTACCACTTTATCTTGAGTATACAAGGACGTGGGGCATTTTTATTTT
TCAATTATCTGGGGCAATTATTTTTATTTTCTAATGATCTGGGGCATTTTTTATTTTCGTGATTAAATGGGGCATTTTTTTAAAAGAAAAATGCCCCATG
TTCTAGTATACTCAAGTTAGCGTGTCACATATATATAGTCATTGTGCTTCAATGAGAGTTAAACCTATTGCAATCACCATTCGCACACAATATGCTGATA
CGTCTGACTACGAAAACAGATGATCCCTTGAATACGGCCACGCGGATATTTACCTGTGACAGAGTGGACTTATGCTATGCTCGCGTATCAACGCTAAATT
CCGTCAATACATATCTGCAAAAGGGCATAAGGCTGTAAGCTAGGTGCAGTAGAGAAACCTTAGGTCGAATCGGGTGTGTAGGTCCTTAATATTTAGAAGC
ACCACTAATTAATACCCATGAACCTTTATAAGAATACGCATAGTAGTTCTGTAGCACATCGCAACAACGCAGCACGTGGTTTGGCACCCCAATATGAACT
TAAGAGGACCGCATGCCAAGTGCCGACGGATACAGTACGACAAAATAATAAAAAATCTTGTTGAAGTCCATACCGTAGGTTTCAATGCAAAGTGTATTTG
ATTCTTTAAACTATGACATATGTGCTGGAGTGATTTAACACTTCGACCAAATCAAACGTCTTGTGTACTAACTCATTACCTCTTGAACTCTTCACGCCCA
GCGTGCCGTTCATGGAGTTTATAGTCGTTAAAAGCACCGGTAGATTCCTGCAATAGCACTTAAATGTCTCTTACAGCACTGGTACTGTTTTCATATTGCT
TTGTATCGTACCTTCATGTTGGACACAGCTTTGTGCACGCGGCAATCTAAGACGGCACTATCTATCTAAGCCAGAGTAAATGACATGTAGGATTCACATA
TCTACAGTGTCAATCCAAAACTTTCGGACGAAACCAATAAAGCAACGTTATCGTACAACAAAATGACAAACAACTTCGATAGACTATACTTGAGGCATCA
TCGAATCCTTTCCTGCTTGCAATACGCCTGCAGTCGAACAAGGCTGCAAGCGTTCGAATAAATAAAATAATATTTAAACAGAAAGAAAGGATTTATTATG
GTCTATTGAAATGGATAATTTTGTTAAAGAAACTAGAGCTGATTAGCAGAAAGCAAATTCCTATCCTAAAACTATTACAACACAACAGCATCACTGCAGT
ACCAACAACACAAAACAGAAAGAACACCAAGAACACTAACAGCGGTAGAAACAACAACAACAGGAGCAGCAGTAACAACATCAACACCAGCAGCAGCCGT
AACAATAGCAACAGGGCTAACAAAAATAACTTACAAGAACAAGAACGGCTACAGCAACATCGGTAGCAGCAACAATGACACTAGCAACAAACAGTATCAA
CTGAAACAAAATTGACAATCAGAACATTAGAAAACACAATAACAACAATAACAAAAACGATACCATCAACTACAACAACATCAGCACTGATTGTCCACAT
ATAAGGCCACCGCCGCCGATATAAAGACGCGTTCACGTCGTTTCTGTACTGTCTGCGCCCGCGACAGACCCCTTTACGCGGCTCCCCCCACAGGTCGGGG
GTTGAGCACGGCTGTTCAATGGAAATTGAGAAATTACTAAAGATATGGATGTTTTATGTACCACGTTGACTTAAGTATACTAGGACGTGGGACATATTTT
TATTTTCTCATTATATGGGGTAAATTTATTGTATTCGTGATTCAATAAGTCATTGTTTTATTTTCTCTTTTCTTTTCATTGACTTCCTGTACAAAAGTGT
ACGCGATATCTCGGTGAAATCACTTTCCAAAGATTGAGTTCTTGGCTAACGAGATATCAACCTACTGAATTTTCTATAAGATTTCTGAGCTATACAGATG
CTGCTCCCACATTGTTAATAGAGAAATCTATGATTTTCTACACTTCTGTAGCAGGCCCACATTCTCACCTTCTTTCTGTATCTCCGTATCTCCTGAATAC
CCATCATTCCCTTCTGCAGATGTGCCACGTGCTCACGATAAACGTGAAGTACTTCAATTTGAGTGACCTCTAATGACAATCATTACAGAAAATGGCTGAG
TCATTTGGCGATGTCACCGTCAGATCTATGTGTACGTATGAGCGGAAATACGAGAAACGCAATGATCGCCAAGGTTATTCAACGCAAATTGACGAAGCGA
GGAAGGATAAATTCTTGATGTCGATATAAGTCATTAAGCTAAAGCGACTAAAAACACCCGACAAGCTGGGTTTAGTCAGCAAAATATTCGACAGGAGGAG
TTGTCTAGACGGCCGCTGTAATGTAGCCACCCTAACTCCTTAGTCATCGGAATACTTTTAGACCTTCAGAATCTCCTAGTATATTGAACTAAACGGGTTT
AAACT