Description :
From Genome Similarity Track
Location :
Scaffold_14:670655- 674610
Transcript NameFunction/comments
Phyin_T30-4PITG_09135Putative uncharacterized protein

Sequence
3955 bases(100 bases per row)
AGGTGGCCACTATAGCAAAAGCCTCTTTTTCCCCGATGGCCCATGACAGCGCAGATCCTGAAAAGGTTTCGCTAAGAAACATCAGCGGCTCGTGATGTTG
CTCCGAGAAAATTTGGTCTTTGTGGTCCGGTGGAATCTGACTTACAATTGCTCCCCAATGTGACTCGCTAGCATCGGTAAATACCGAGAGTGGGTAGTTC
GCTTTGACATGAGCGAGTTCCACTGCGTTTCCTAATGCCTCTTTACAGGCGTGGAGACACTGTGTGTGTTCTGATGTCCAGCCAACGTCAGCTAGTTTTA
CCCGTAAGACTTGGCGACGGGATCGTCCACCAGCCTTCCGATATACTTCCTCCAAGAGGTCCATCAGAGGCTGCGTCAACTTGTTGTGGCCTGGGATGGA
CATCCTCATCCAGCCCAGCGCACACACAAATTGTTGCAGATCTTGACTGGTAGCGGGTACACCTAGCTCTGAAGAGCTCTTATCCGTTCCGGATCGTGGC
GGACTCCATGTTTTGAGATCAAACGTCCACACCATTTTGCTTCCTTCAGATAAAAAGAACACCTTGAGGGATTCAACTTTAATCCCTTGGTAGCACACAC
TTTAAGAACTCCTCGTAGCAGCGTAAGCAAACCCTCCTCTGACTTCGCGTAACCCAGTAGGTCGTCCAGCCAGATTAACAGACCGGAGTACAAGAAGTCT
TGGAACATCACTTGGACCGTGGCTTGGCAGTAGGCCACGCTGTCTGAACCCCCCATAAAGACGCGTGTCGGCGTAAAGATTTCCATGTCCGTAAGAAAAG
AAAATAATTCCTGCCACTCGAGTGACAACAGAAACTGCCAGTACCCCTTAAAGAAATCCAGCAGAAAAATGAGCTCTGATTCATCCAGATACTTCCAGAA
TGGGCATTGACCAGAAAAGCCTAATTGTCTGAGCATTTACGTGACGAACGCTCACTGTCATGCGAAATTGACCCGGCTGCGCTTTCTTCACAATCAGAGG
AAAGGAATACCACTTGCTGTGAGGATTGCGATAGCAAAGTCCAGCATCAATGAGCTCTTGAACATGTTTATTCATAAACGCCCGGTGCTCTGGCGGATAC
CGCCGAGCTTTACACCTCGATGGCACAGCGTCCGTTTTCAGAGTCACTTTCAGGGGCGGCATGTCGACTGGAGGGTCCCGCCCGAGTTTAATGTGGAAAA
CATCACGGTTTTCAAAGAGGATTTGTGTTAGTTCAGTTCGGAAAGCAGTACTGCACCCCAGCTTCGCAGCCTCCTCCAGCTTAGCTTCCTGTATACTCCA
CTCGACTGCACGCTCATCCTCTCGGTCCTGAGCGAAATCTACTTTTGGAAAACAGCATTGTTCCTCCTCTTCCTGCAATCCTTGTTCCTCCGGCGTAGTC
GCTGGTTGTTGACCCGTCGATGCATATGCTAGGACCCGTCGGACACCGCTCACCTCGGAGCCGTCATCCATGTCGTATATTCCACTCACGCTTCATGCCT
TATCCAGTAGCTCTTGAGGATTGTAACCTAGTCGTCCCATGACGCTTTCACTTAAAAGAATATCCCCCATGCCAGGGGGCAGGCCCGCACCCACCACCCA
ACAGGTGACGTTTTTCAGCGTCAAATTCTCATTGGCGGTAGCAAACTGCAGATCCAACTTGACCTCCTGAGTGATAATCATCGGTTCCTTGGTGATGCCC
TCGATCGACTCGCTTCGTGTAAGGTCCCGACACTTCATCCACTGACCCTTCGCACTGAGTTCCTGGAGTAAACGAGGCGATACAACCGACACTTCCGCTC
CGCTGTCCGGTTTAGCCTTGGCTTCTACCACCCCGTTAAACATACACTGTAGCAGACTGGATCGCCGCGCGAGTAGTCTGCACCTTACTGAGTACCGCAG
GAATTTGGGGAGCTAGTGCGACAGCACCCACTGTCTTCGACTGCTTCCGGTGTTTTCATACAGCTCCTTGGCTTCAGTGGCACTCGCCAACGGACATTGA
AACACCCCGTGCGTTGCATCACCGCACTTAAAGCACTTGCGTGGTTGCCCCGGTACTTTGGTAGCCGACGACGTTCCTGGAGGAGACCCCCGGCGCGGGA
CTGCGTCTTTAGAGACTGCTCCTCCTGGAGCTCGTTGAAACCGGTCGTTTCTACGCGTATTCTGTGGCTTGAAATTTGTCTTGTCTTGGCTCGATAGAGC
ACCTCCGCTTGGGGTAGACGAAACCGTGTGCTGAATTGCGGACTCAAAAAGCAAAACCGCCGATACTCGATACTTGAGCCAATCCAGAAACACCTTTACC
GACTTCTTAGTGGACTTGTGGACTGTGCGTTTCAGCTCCGTAATGACCGTCTGCTTGAGGACTTGAGGCTTCAGGGCCGCACACAAAAACTCCACTGCCA
TTTTGGGATCTTCCAGCGGGAAGTCATCCATATCCTGCGAGTCGAGAATCTCGTTAAAGTCTGTCACCAGTTTCATCACACGTGATTCTGCATCCGGTAG
GGATGTACCCATGGACAGCGCCCGCATGGCCTGTGCCAATCGCGCAGGGTCCTGCACCTCTGAACGCCTTGCTTCCAGGAAATACGACTTCCACTCATCT
TCGGTGATTTCCGACTCGGCTTTACCAATCTCATACATACAAATTCGGATTAGTGTCCGATGCTCGATACAGGTGCTCAAGGGCATCACAAAAACCCTTC
CAGCCGAACCCTGATTTAGCGCGGTGACTCTCTGCTTGTATATGAGATAACTATCCATAAACGCCTTCTTCTCCTTCTTTGTGGCTCCTCGATACACAGG
AGGCGACGGCATGTTCGAGCTCGTCGCCATGGTGATTGTCGGCTCGACTCGGCTCTCACTTAGGTCTCCACTCGTCATAGCTTCATCACCATCAGCTTCA
CGAGCAGTTCTACCCGCACTCCGGTCAAACCAGCCCCAGCGGCTCTGCCCCCGTGGGGAAAGTACCTCTACCTTCAGATCCTCGATCTGACGACCTTGGT
GTCCCACTGTTTCTGCGGCCTCCCGCATCAGCTGGTACTGCTCAACTAGTGCCCTCTACTGCTCCTCGAGCTGCGTGCTCAATGCTGTCTGTTTGGCGTT
CAGCGCAACTTAGTTCTCGTACTGCTGCTGCAAGTACTCAGCCGTTTTCGATGCCAATGACTCCTGTTGCTGCTAAAACCGGTTGAGTTGCTCGACCGTA
AGTTGCTGGACTGCCTCAGCTTTCTTGGCAACTTTATCGACCTTCTGCCCCGATTCCGCCTGGAGGCTGCGCGACAGCGACGACTCGAACGTTCGGGTTT
GACGCTGCGCCACTACAACATCTTCCACGGTCACTCGAGGTGAAAGAGGTGCCTCCTCGGCCAAGTCACAGCTCCCGTGAACTGGACTGCTCATCGCTTC
CACTTGCCAGAGCGAAGTGAGCTAAAGAATTCTTTGTTATCTTCGCACTTGTTGTAGGTGTGGTAAAAGACAGAATGAATGAAATTGAGAAAACTTAAAA
AAAAAAAGAACTCCTGTACTCCTCAGCTACGACCAGTCCGGCTCGGCCGGCCTAGCTGGAACTGTTGTGCAATCATCCCACTTACTTCGTGCCTGAATTC
GTCTTGAACGCGCGGGCTTCACGCCGGCGCGTCACGCGCCGCAACTCACGACAGCTTGATCTCTTTTAATGCGTCCTCTTAGCAGGTATCGGCTGGCCAC
CTTGAAGTTGTGGCACGTAGATTGAAGTAACAGCTGGTAGTGAGCTTGAACCTCGCTAGCTGCTGCTACTGGAGCCATCCGGCGACAACACGGGTAAAGA
ATTCTTCAAACCCGTCGAAGAAGAAACGGCGTTCCCCTTCTGTGCACCGGAGTTCGAGAATGTCGTCTACTACAACTACACTGCAGCCCACAAGGATTAG
CATCAACCAGCGTGGTGTTTAAAGAAAACGTGGTCGATATAAAAAGAGCTAAGAA