Description :
From Genome Similarity Track
Location :
Scaffold_599:6706- 8183
Transcript NameFunction/comments
Physo_145193hypothetical protein

Sequence
1477 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGACGCAGCCCTCGACTTACGAAGACACCTGAAGACGCTCGGATGGCTCGGACGAAGGTCGCCATGCA
ACCCACGACCCGTGCGACGAGGAATCAGCCAGCGACTCAGACTCAGGCGTCCGTTCCCGTACCTACTGGAGGATCGGATCTGGCGCGACAAGAAGGTCAG
GAAGAGGCCGAGGACGAAGAGACGAAGGAGAACGAACCGGACGACGCCGACAACCCAAGCGACGAACGAGTCGATCACGGCGCTGACGACACGCAGGACG
CGCCACCCGACGAAGCAGCAACCAGTGGCAACGACGACGGCGCAGCGATGGCTCCTGTAGCGGCGCTGACCGCTGCACTGCAGCAGATGGCAACGACGAT
GGCAAGGATCGACGCGAGGCTGGACCAGCTGAGCACCACGGTGGCCAACCCCGCGCCGTCCCCTGCGCCCGCGGACGCTGATACGCAGACGGTGGGCACG
ACGAATCCGCCGACACAGCAGGCACCGCCACCCGCTGCACCAAGGGACCCTCCGCCAGCGGCTACAGCTCGGCAGGTGGCCTACCAGCCACGTGACGGCA
ACGACGACGGAGACGACAGCGATGATCACGACGACGACGGGTCTTCGAGCAGCTCCGACGACGACGACGAATCTGACGACGGCCACGACGGTGGAGGACG
CCGCGAAAGACGCCAACCCGTTACGAGGCCCGGTGATCGAGACTTTCACCGCAACAGACGGCGAGCTATTCGAGACCTGGACTTGCCAACCTTCTTACCG
ACACCACTGACATCTGTGACGACGTGGATCGCGCGCGTTGACCTGGCACTCGAAGGAGCACGACTATCAGGACGGGGCGAATGGACTGATCAAGAATTGT
ATTACATCTTAGGCAATAAGCTACAGGACAGTGCTGCCCGCTGGTGGGTCCAGCTGGATCGTAAACTACGCGACCGTGAGCGAACGTGGACGAAGTTGAA
GTCGTCACTGCTGCGACGATATGGTGAGCGCCCGGATAAAGCAATGGCCGAGTGGCGTGTCGGTCAACGTAGGATGA