Description :
From Genome Similarity Track
Location :
Scaffold_529:6705- 7712
Sequence
1007 bases(100 bases per row)
CACGCTCGCCAACATGCGGACGCTCCACGCGCAGCTCACACGCTTTGAAGTGCTCCGAGACGCTGATATTGTCGAGCTCTTGCGCGTGCTCGCGGAGTTT
CTCATTTACTCGGACCAGCACCGCGTGTCGGCCGAAGGTGAAGACGATCAAGATGCAACAGCGGCTGGTGCTTCTAGTGATACGTCCGTGGAAGACCAGA
CAGGGACAAATGATGACGCGGGCGCGTTCTTTGACTACTTTGGAGAGACAAATATGCTCGCGCTGTTTGTGGAACTAGGGGCCAGTGCTCCGTCAATTGC
TGTCCAAGTGCAGTTACTTCAGACGATGAGCATCTTGGTGCAGAACATTGCGACCCGCACGTCGCTGTATTATATTTTGAGCAACAATCACGTGAATCGG
CTCCTCGAGTGCCCATTTCTCGTCGATCAAGACGATGACGTGCGGGATTGGTACGTCACGCTACTGAAAGCCCTGTCACTAAGACTTAATGACGAGACAG
TGCAGTTTTTCCTCGACACGCAGCAAGGAGGAGAGGAAAATATGGGCTTTCCACTCTATGCACGAGCGTTGGCGTTTGGACGCTGCAAGGAGACCATGGT
GAAAGTCGCGGTTAAGACATTGACGCTCAATGTGCTCAACGTGCCGGATGTGCGGGTGCGCCGGTTTGTGCTGCAGTATGACAAGCTCAAGTATTTTCGA
GACATTGTGGAGATTGCAAATGACTTGACTTTCACGATACAAGGACTATTGAATACCTGGCCATGCGCAGCTGAACAGACAGCGAAAACATCCACGTCGG
AGAAACTAGAAGAAGCAGTGGACGCGTACATTGACCACTGTTTTTACTTGCAGGATCTGCTGACAGTGGATGTACCGGAACTCTGCTACGAAATTGGAAA
CTTTCTATTTGCGCGGCATGTCAGGTGTTTGTTGGCGGCTAGTATCCTACCAGATTGCGCACCTCCACCGCAAAGAGTGTCGACACAACTGGCGCTCTAC
TTGCTCA