Description :
From Genome Similarity Track
Location :
contig_45:67035- 68150
Transcript NameFunction/comments
g8037.t1hypothetical protein PHYSODRAFT_309392

Sequence
1115 bases(100 bases per row)
CATGACGCCCGTGCAGGCCGCCACGCTGCCGCTGTTCCTGTCCAACAAAGACGTGTGCGTCGACGCGTGCACGGGCAGTGGCAAGACGCTGGCCTTCGTG
CTGCCTATAGTGCAGCTGCTCAAGGCCAAGCTGGCGGACGGCAGCATCACGGCGCCGCGTCACGCCGATCTCACCAAGCTCGTGGCGATGGTCGTGTCGC
CCACGCGCGAGCTGGCACGCCAGATCTTCGAGTGCGCCGAGAAGTTCTTTGCTGGCGCCTTGCCCGGTGTGCAGCTGCTACTGTTCGTGGGCGGCACCAG
CGTGGACGAGGACCTGTCGCTCATCCGCGGCGCGGTGGGCAAGTGTTCGGTGGTCATCGGCACGCCTGGCAGAACCGAGGACTTGCTGAACCGCTGCGTC
GGCTCCAGCGTCGAAACGCGCGAGTTCGAGATGCTCATTCTGGACGAGGCCGACACGCTGCTGGACATGGGCTTCGAAGTGAGTCTCAACAAGATCCTGG
AGCACCTGCCCAAGCAGAGACGAACGGGCTTGTTCTCGGCCACGCAGACGCAGGAGGTGAAGGCGCTGGCACGCGCAGGGCTGCGGAACCCAGCAACGAT
CTCCGTGCAGGTGGCGAACAACACGCAGGTTACGCCGACGACGCTGCAGAACTACTACTGCTTGGTGGGCCACGACCAGAGACTGTCAGCGCTGCATCAC
TTTGTGCAGTCCAAGAAGGGCCAAAAGCTGATTGTGTTCTTCTCCACGTGCGGCTCAGTGGACTTCTTCACACGCGTGCTTGAGGAGCTATTCAAAGGTG
ATGAAGCCATCCCTGTTGTGGGGCTGCATGGAAAAATGCCTCAAAAAAGCGTACGACGAATTATGACCGCTTTTCGTCGCTGGAGTCGGGACTGCTGGTG
TGCACGGACGTCGTTGCCCGAGGTATCGATCTGCCGGATGTAGACTGGATTGTGCAGTACGATCCGCCGCAGGACCCGAACTTCTTCGTGCACCGAGTGG
GTCGTACAGCACGTGCAGGCCGATCTGGATGCGCCCTGTCCTTCTTGTCTTCGAACGAGGACGCGTATGTGAACTTCCTGAAGATCCGTAAGGTGCCGTG
CGAAGAGATGACACT