Description :
From Genome Similarity Track
Location :
Scaffold_557:6701- 8093
Transcript NameFunction/comments
g13041.t1hypothetical protein

Sequence
1392 bases(100 bases per row)
AACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGT
ACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGACTGGCCTCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGA
GGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGACTTCGACTGCCTGGAATTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGC
GTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCAATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTGTACATCAAGGTGGTGGACGGTCACTGCG
TGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCTGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCAAGATGAC
CGACAGCGGCAAGTGTGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGTCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTG
AAGCGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGT
TTCGCGAAGCTGTTGGTGCGCTGATGCACCTGGTGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGCGTCGCGTTTCATGGAGAACCCCCA
AGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGT
GGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAACA
AGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACGTCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGA
GATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGTGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGC
GCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGCGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACA
TCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGG