Description :
From Genome Similarity Track
Location :
Scaffold_1827:670- 4721
Transcript NameFunction/comments
Phyag_g11565inositol-3,4-bisphosphate 4-phosphatase, putative
Phyag_g11566hypothetical protein

Sequence
4051 bases(100 bases per row)
CAGAGCCTCCTGCGACTGCCATCGGAAGCTTCAAaggcagcaaaagcaagagCAAAAGAGACAAGAAGCGAGTCCAGAAAGAAACCAAGGACGCAGCCCC
AACAATCCCAGGGGTGCCTGAGGACGAAGGAATGGCGAAACTCGGTCTGACGGACCCGTCGCGACTCTCGGACATGACGCAGCGCATGAAACCCAAACTC
CAAGTGTCGGAGAGTGGCCGCTTCGAGGATCAATTCTACCACGCGCACGACGGCAGTAAAGCGATGGCGAGACTGCGCAAACGCGCGtaccagaagaaga
cggtgcaCATGAGCGGCAATGACGTGGAACAGTTCTCGGACGCAGACATCATCACGAGCGGCTATTTGGTCAAGCAGGGGTCGTTCTGGAAATCGTGGAG
ACGTCGCTTTTTCATCTTGAGACGAGACCGTCCTGTGCTGTGCTACTACACGTCAGCAGATGAACTGGCCAAGCTCGGAGAGATCGCAATCGACGAGAAC
ACGAGTGTACAACTCACGCCTAAGGACGGATTCCCCTTCAGGTTTATTATTGAAAATGAAGGGCGTAAACTGACATTGTTCGCTGATCAGGGAGAGGAGA
GCATGGAGGCCTGGATCTCGTGCATCAACGGATGCATCACGCAGCGAGCACGGTCAGCGTCTCGCGTTACAATGAACGGGTCGTTTGATCGCCGATCGGA
AGGCGGGTCGTTCCGGACCCAGCTGCAAGGACGTACCTCGGAGAGTACGCCCATGATCGACGATCTCAACATGGACCGCGCTAGTTTCTCACGCATGGAG
AGTCCGCACATGACAACCGGTATGAACGCCATGAAGCGTTTCTCTACGGACACAACTGTCATTCAGCAGGCTGCCAACGACTCCAGAACTGTTCGAGAGA
ATGAGGaaaagcagaagcagcagcaacaacagtcCAGGCAACACCGGAACTCACGACTGACTAGCATAACTTCCGCCCCAGTTGATGTGGCAAAGACTAA
ACCTCGCCTTGTCCGCTCTTCCAGCGCCGGTTCCATTCTCACCCAGTCGTCTTCGCTACCCGTTGGTTCACGCGCATACGACGACAATGGGCTGTCGATG
TTGCACTCACCCTCTCATTCAGCAAGCGACCTCCAGGTGGCACAGGGACCGTCGAAATCTAACCGCGCACCTAGTCTCAGCTTGCCAGGATTCAAGCCTC
GTCCTAGTGTGGAATTGGCTGTGTCTGTTGGGAGCAAGGCCGTCCAAGATGTTCCGCAGATGCTGGTAGTTTTGTTCAGTATCCAGCAGGGGCAACTGCC
AGAGGAGATCTCACGCACAGAGATGCGAAGTTCGCTTTCTCTTCGATCTTGCGGTGGTGACTTTTACGCGCGTGATTTTAATGCGTTACTTTCGGTACCG
CGAACAGCACGCTCGATGCTCCAAGTTGAGATCTTTTCGGTGGTGAATCCTGCAtcggaggcgctggagcatCAAAAGTCGCTTGGTTTTGTGCGAGTTT
CAGCACTGGATGTTCTTTTCTCACGAGagtcgtcgatgctgcttgaGTGCCACCGTACGGATGTATCCAAACAGCTTTACTATCTCGTTCTGGATCGGTT
TTCTCCGCCTGGTCACAGTATTAATGTGAGCCACGCATACACTTACGCGAAACACCATTTCCTTGTGGACACAcagtcgatggagaagcgcaagtcAGGT
GATATCATGTCTAGCTCTACGATGAGCTTGAGAGGCGGTTTGAGTTACAGCGAAATGCTTCGTGGCCAAATGAACTCATCCACAGCCAAGCATGTACTTG
TTTCGGAGGAATTGTCGGCGTCTTATGTTTCGGTGTCGATGACTGTTGCCTTTCTGAAGTatctccagcgacgaaatgTCACCCGCATCGATGAAGCGAG
GCAGGTGACCCACGACATGAGACAGCATATTAAAGCGAACACAGGTTCGAGTTCAACTGCGAATTCTTCAAACACTCGTGtccaggaggtggaggatcGG
ATGCGGGACGTGGAACTTGAGATGGCACATTACATGCGCCTTCATGCTTCATATCAAGAGAATTTGAAGCGATACGAAACTATGGCTGCATCGCTCGAAA
ATGGACGGGAACAGGGCATCACCGGGTGTttgaagcgcagcaacatgaagaaggacaaggctACAGCGTTCATGGCTACTAATCTCAACTGCCATCTTGT
GCGTGGAAGGCGTGTGCACCTcgctgacgatgctgaaCGAAGTGATCAAGCACGGAGAGGTAGCTTAGCATCTACGTCCATGGAAGACGCTTCCACATCT
GATGACAGCGATAGCGAGACATCACCTGCGTCTGAGTTTGTGTACTCAGTAGTCACGCACGGTTGTGCCTCTGCCCACATTATGGGATTTAAAGAGGGTG
GATTGcgtcgcctccagcagcagttggcTTCACAAAGCCCACCAGACCCACGTCTACGTGAGCGCATTGAGATGAGAGAAGATGTGGTCCGCTCGCAGGT
GCTAGCAATCGCCGGAGCTTCTTTCCTGAATGCCGTGGGCCTTGCAGCTACTCGCGGCGGGCAACACCGTCAACGATTGCAACTTTCCTGCTCAACAGGT
TATCTGCTCAGTATTGAATCGCTGCTGAGCACAGTTGGTGCCGAAAAGGGGATGCTTGAGGACATGTCTGAGGGAATTCGGTGGCTTAACAATGTGGTGA
GTTTCCAGCTTGTCCAGTCGGCAGAAGCTAATCCTCGCATGGAGATGTCGAAGTGCGTTAGCGTGACAAGCACACCAACCGAAGACCATGTTGTGGTTGC
GTTTGCTGTACCGCCGGATGTGTTCTCGAAACTCCCAGAAGTACTGCAGCAGGGCCATGCTATCAAACTCCACGGAGTGATGTTTACTCAAGGCATCAAC
GAAATGCAATCGGTGGCAAATCACTACCTAAATTCCAGTCTGCAGGACGAACTCAATTTTGAGAGTGTGCAGATGTTACAGCGGTATTTCCGAGTTTACC
AGACACAAGTCACGGCTGGAGTAGGGGGTGATAAGAAGCGTGAAGCCGATCTAACCGAGTTGGCTGAGCTCCAGTCCGAAATTGAAGCGCTCACTGGTCG
TCTCAATGATCGCACAGAGAATGTTCAAAAGAAATCAGTGAACATCCTAATCGCGTCTAGCGATATTTGCCGCCGCCTTGGTGCTGGGCGCACGACGTGC
TGCAAGAGTGGCAAGGACCGCACAGCAATGTCGGTGACATTGGAAACGTCTCGTTTGCTTGTGGACCACTTCCATGTGAAGCAGGGTGTCCATCTCTGCA
ACGCCATGAGGGAGCGTGGTGTTCGCCGCATCAACGTGTTGGCAAACACGGGGAAGACGAAGTTTGCATTCAACTCGTTCCAACTCAAGTATATTCCTGA
TTGCTACAAGCCGCCACTAGCTTGCGCGGACTCTCACGTAGCGTCATAGCGGAGGCCTATCGGTAGGTAAGTTTGCCATGTTGTTAGCCGCCTGTGGTTG
AGTTCGTTGTACATTGTAGGATCGAGGTGTCAATCCCACAATGGATCGTTCATCATTTTGAGCTCCTTCTCTCGTTTtcgactgcgctgcagcttctgga
cCTGCTCGCAACATGGAAACACACCACGGAAACAAGGGGAAGTAGTTTTAGCCTGGTGACTCCCAAGACTCGGTTGTTCTTGCTTGGTGCGCACCGCGAA
TCGCAGTTTCTGTTCGTGTTCTCGGTTGATCTCCTCGAGTTCGTCAACCTTCGCTTGGAGAGTCGCCACCTGCGGATTGAAGTGCAGGgcttcgtggagc
tgctcctccaccttgcCAATCTGCTCTCGATACTTTTGGCGAAGCTTGTGCTGGCAATAAAACCCCATGGTCAAGAAAGCAAGCCTCAGATACGACAACG
TGTTCCAGTCTTAcctgctgatgaagaagttgagcgGCGATTTTCTCTCCAAGCGCTGCTACCTCACTACGTTGGGCGCGCAAAGTGgcttgctgctcca
gcagatgaagaagcagttcGTCCTTCTCTCGCGAGCCGATTTTCTGTAGTG