Description :
From Genome Similarity Track
Location :
Scaffold_173:670- 3631
Sequence
2961 bases(100 bases per row)
GCGAGACGAAAAGTGTCGGTAACGTCGCTTAGCGATATTAGCGATTAGCTATATACATTGTTCGATGGCGTGACAGCTCACGTGGATGGTGAAGTTGGCC
TTGCAGCCCTCCCATAGTTAACTGCTCTGTTAGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGCGATTTATCCGAATTAGT
GGTCATTAGACCCGATGTCAAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCAGAGTAGATCTTCGA
TCCTTAGAGATCCTTTGGATCCATTCTATCCTTTGGTAAGGAAATTTCAAGATGTGATGTGTCACAACCCACCATCTGTCTTACCTCCCGATAGAGGTGT
ACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACATAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGT
GCTAAGCACGCGGCGGGAGAGTAAGTCGCCCCATTCCACACCTACGTCTTGTGTCAAAAAGCGTAATGGTAAGTGGCGTATTGTGCCCACTTATAATAAG
CTCAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGAATGCTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAG
TCGATCGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGATTAGTACCCCGAGGGTATGCTCTGGTAGTGGCTCGTTATGCAACAA
GGGCTGTCAAATGCCCTGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTGCTTTGATGATATCTTTGTCC
ATAGTTGTGCAACGAACGGTCGAACTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCACAAATAAATTGTATGCAAATGCAT
CTAAGTGCATCTTTGGTGCAGAAGAGATTTACTTTCTGGAGTGCTTCATTGGAAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATAGTCAA
TTGGCCGGTTCCAAAGAACCAGACAGATCTACGTAAGTGGCTTGGCCTTGCCAATAACTTGCATAAGTATAGTGTGAATTACGCAGACATGGCTCGGCCA
TTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAGCATTAGGCTTTTCAAGCAGTTAAGGAAAGTATCCTTCATGCGCCAATAC
TGGCTTTGCCCGATCCTGATCGGCCTTTCAGCGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGCGCTCTGTTACAAACAGATGTCGATGGACGCGA
AAGCGTCATTGCATTCGAATCTAGACAGCTCAAAGCTGCTGACAAGAACCATCCAGTTCATGACACGGAGCTACTTGCTATGAAGTACGCTCTAGTCGAA
TTCAGAGTACATCTGATTGGCTCAAAGCCATTTGTGATCTACACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAAAATGG
CTCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGCGAAGTATAAGCCAGGAAAGCAAAATGCTCTGGCTGATGCGCTATCGCGCCGACCTGACTA
TGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTCCTCTT
GGGAGCGAGGAGTCGAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCCATATTCTATCGATAATGGCCTGTTGTGCTATCGCA
CATATATTGAGGATAACCCTCATATTGCTGTCCCTCGTGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGATCATCT
CGGTCGTAGAAGACCTATAGCTCAGTGAGCCAGGCTGATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAAC
GGGTGAAACCCTCAGCACATGTGGCGGCGCTGCTGGTTAGTCTGCCTGTGCCCACGGGGTGTTGGGAGTCCATGAGTATAGACTTTTTTGTTTGGCGTAC
CGAAAGATTCAGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCGAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCCGAAGG
TACAGCGAAGCTGTTTATCGATCGTGTGTTTTGACAACATGGTTTGACAGTGGAAATTGTCTCTGACAGAGATCCCCGCTTCACTGGGCAGTTTTAGAAG
TCCATCTTCAAGGTGCTCGGCACCCGTTTTGACATGTCCACAGCGGATCATCCGTAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACA
TTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTATAGGCTA
TACTCCGTTCTACGTAAACGGTCTCACCCACCTTCGCGTTCGGTTGACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTT
GGTGATATCAGCTCTGCTACTATTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGAGTGAATGTCTTAAGACATGTGCGTGACGCAATGACTGAAAGCC
AAGACCGACAAAAACAATAAGCGGATGCTAAAGGCGGAAGCTGTATTGAAAGTTATGAGGTTGGTGACCGAGTCTTACTAAATGCTAAAAACCTACCTAC
AATGTAGTGTCTGCTTTAATAGGAACTTAGTTCCGTAGAACTAAGTGACTTCTAAAGTCGT