Description :
From Genome Similarity Track
Location :
Scaffold_1271:670- 3046
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1271-snap-gene-0.1Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1271-snap-gene-0.2Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1271-snap-gene-0.3Rap guanine nucleotide exchange factor (GEF) 4

Sequence
2376 bases(100 bases per row)
CGGCGGTGAAATCGTCGAAGTTATGATCATTCTCGGTTCGGAACGTGCCGTGAAGGTGTTCCACAAGCCCCAGGTAAACCTCGGAGCAGGTCTGGACGTC
ACCGTCGGTCCCTACGGACGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCAACTACAGTTACTCGCAGAGCAAAGGTCTGTACGCGGGCATTTC
GCTCCAGGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGTCGAGGATCACCACAACGAAGTCGCGCGCCGCTCGTCCATCATGGG
GCCCTGCCGCTTGTGCAACTGCCCCATGTTCGTCGCGCATACGAAGCAAGTCTGGAACAAGAACTGCAAGACCTGCAAGCATGTGCACTAAGAAGTAAAG
CGAACCCGAGACAATATATGAACCATTTTGCACAGTACGCCACGGACGACGACCAAGTTCAGACAAGAAAGTCAAAGTGTGATGACAGGGAAAGACAGCG
GCTGCGTTGTATTGTAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCACCCAATCCACCATCCAATTTTGATGTCGATGCTGATGGAACTGGCTGA
CGTTCGCGTGGATTTGCTGTTGCTGGTTTATTTCTCACTCCCTGTCTTGTCATTCACTTGTTGTGTTCGTGTTGAGATAATTGTGTGATGCAGGTGCTCT
GCTATAAATGGCTCCAGCCTCGCGCTTCTTGCGCATCAATGCGAACTCACGACCTCAATCCCGAGCAGCAGCAGCACGCCAAGCCGTGCCCATTTACTGT
AACCCATGTTTACGAGTCGACGGCGCAAAAGCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGACCCCAGGGCTCCAGGAGGGATAACTCC
GCAACAGCGAAGACTGAGCAAAATGAAGACGATGGTGCGACCGCCGGGGCTCATCGCTCCAGAGCAGGACGAGAGAGTTCTGCCAGACCCTGCTGCGTCA
AAAGCGCCATCGAGTCCAACTTCGTCAGCCAACAAGCACGCGGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATCGCAGATCGCCGAACACGACGACGAGGCTGCGAATGAACGAGATGAGGTACGAGGCGCCGCCCAGACAGAGCAGCCGGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAACGATAAGCGGGAACGAGTCGCACGCGCAGGTCTCGCTGGCGCACATG
CTCCGGAGCCGCGAGATCAAGAACTTCGTCAAGCAGTCTGTGGTCACGAGTCGCTGGAACAAGCAAGTGCTCCAGTCGGCGTCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGTCGCCGCTGCACGAGAGCGGCCAGTCGACCGTCATGGAGCACTGGGTCAAAACCACGATGCTGCGCAACCAGGCCGATGTCAAAGAA
GCGGGCTTGGGGAGCGACGAGGACGACNNNNNNNNNNCGGGTATCGAGTCGGGCTTCGACGTGCGCACGTCCAAGACGAGACACATGTACGGCCGCACGC
TACTGCTCGAGGAATCGTGTCGCCGCGCGTTCGCGCAGAGCAGCGAGAATCGGTCGCAGACGGATCTCCAGGCGCTCAAGGCGTGGTTCCAGATGACGAA
GCTCAAGATCACGACGGACTTTGAGCGGCTGCAGCCTGCAGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGGCGCATGACGCTC
GTGTCGTTCCACCCGAAGGAGATCGTGTTCCGCCAAGGTGACGAGGGCGACGCGCTCTACCTCGTATTCTCGGGCTGCGTCGAGGTTCGCGTGAGCCAAC
AGATCCTGGGCGAGAAAGTCGAGGTCACGGTGTGCGAGTTATCGAAAGGCGACTACTTTGGCNNNNNNNNNNTCGCTGCTGAACAATGACGTGCGCGCCG
CGACCGTGACGGCCAAGGTCACGACCGACCTCGTGCGCATCTCGCGCAAGGACTACAACATCATGCTCAAGAAGGACCAGATGGAGTTTCTCTCGCGCAT
GCAGATGACCAACGGCCTCGTGATCCCCAAGTCGGCGCAGCAGTCGCAGCGCGAGTACATCCAAGTGCTCACNNNNNNNNNNNNNNNGCTCACGAAGAAG
AAGAATGCGCGCACCAAGACCGATATCGACATGCTCAGCGAGTACCTCCAGACGCTCAAATTTTTCCGCGCGCTCC