Description :
From Genome Similarity Track
Location :
contig_234:670- 19363
Transcript NameFunction/comments
g14386.t1hypothetical protein
g14387.t1hypothetical protein

Sequence
18693 bases(100 bases per row)
ATAGGACTAGCTCAAGGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCG
TCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTT
GCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTC
ACTACCCGCCGAGGTTACCCTCGGCAAACCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGGTTCGCGCGAAAGCGCAATATT
GCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGA
TCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGAGTCATACCGTTCGGTAGTGAGATTTTC
TGCGTGTTCCTACACGACAGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTATCGTACCCTCGGCTG
TGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCTCAAGGATGACCTACAGAGGCTCCCAG
AGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGA
TACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAG
GGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAG
GCGTGACTGCCGGTACCCTTCCTTCTGAAGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTT
TAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTG
ACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGAGTCATACCGTTCGGTAGTGAGATTTGCTGCGTGTTCCTACACGACAGAACCAAGGATGAGATAGG
CCTTAACCGTAAATCAGAACCGAATTTGCCCTGAACTACGCAAGAGCTTCACCTACGCAAAGAAACTGAAACTACATTGACCCTACAAGGTGTTGGCAAA
ACAAGGATAAGTTGATCTAGATGTTGTGTAAGTCTGGATAATATATTGATCAGATCTTACCTACACTAGTGATCTATTATCAAGTGCAGATCTCAGATCC
GACGGAGTTATTACTTGGCCCGAAGATCTCTCGGTTTCTCAACCCCCAGAGCCCCTGCTATTGGAAGCGGCAAGAAACGCAAAGGAAGGAGATATCCACA
CCCCAAATGCAAGCCCCAGTGGATCAAGTCCAGGCCGCCAGGTCAGAGCTCGATTGAATCGCTCTCAATCTGGATACAGGACCGGCAGCAGAGCGAAGAC
TTCCGCGTTGCTCCACCCCATCTCCGCGTCCCGCCAGGACGGTCAAGAAACGCACCGCAACATGTCTTCGGGATACTCAGAGAGCAGCTCCAACCCGCCA
ACGGTACACAAGGTGAGAAGTTCAGCTGATCACGGATCATCGGAGGGCCCCCTCCGTTAGTTGGTGTCTGGGCATTGTTGGAAGCCGAATCCAGTCTTAA
CCACATTTCGATGGATCCCACTACCTCACATTGGTACCATCCTGCTGAAGCGTCGACGATCCAACCTTCTGCGGGTTGACACATGCACTCCATCCGCGCG
TAGTTTGTTCCAATTTAGGCCGTGACAGAAAGGTATTCAACTGTCAGTTACTTGGAAGGAACGTAGAAACAAGGGCTAGACAGGATTGAATTCGAACGTG
GCGACTTTTTAGATTGCCGATAGGTTGAGGACCAAGCTGAAACAGCTTGTCAGCTGCTAATTGCTTCGTCCGCAGAATGAGTCGTGGTGACGGTTCAGGA
GTCAATCCAAACGCCCATTCGGTTGGACCCGTTCACATAGCACTCTGAAAGAACTTTGATCAAAGGGCCCATTTCAAACGTGCTCGCAGAGTGTAGTCTC
TCTTGATAATCCGATGAACTGTTCTATAGAGTTGTCGGTCGTAGCAAACCCAGGTTCCGAGGAACAGGACTGCCACATCAAATAGCGTGAATCAGCAACT
GCGTCTTGAAATAGGCAGCGAAAACATTAAGTTCCTATTGGGTACTCCACTGCTTCAAATAGAATGCCTTGCATTGCGTGAATTCTGCAAAAATTGAACA
GAAGTGCATATCGTAAATCTGCGCCAGGACACAATTCGCTACTCAATTCTGAAGCGATTTCGTCCGTTTTTGAACCTTTTTCACGGTATGAAAGAAGCAC
ATCAAAAAGATGAAGTTGGAGTCGTACCGGAATACATACTCCAATCCGTTCAACTGCTCGTCTTCAGCGTCTCCCCTCACAAATGTCAGCCAGAGTTGCT
TCCTGGTAACATTGGTGTAAATAGAGTGGAATGAATATAACGCCATCGCATACACGCTTCCAACACACTGCGATATAATGCAGAAAGCGACCAAGTGAAA
TTTGTGCGAGCGGTCTGACATGCCCAACACTAGCACGGGATAACCGTTCTGCGACGGTTTGAAGATCGCATTGGCATGAAAAATGAAGGAACCAGGGTCC
CGATCAAGACACGCCGACAATTTTCTGGTAGTAATCCCCACGGCGATGGGTTCTTCCTCCGAACCATCACCGACGATGAGCCGTCCATCGGTAGTTTTGT
TATACATAAAAATAATCAAAGCCGATTCATCGCTATTCCCATCGTAGGTTATAGCTCGAACAACCTTCAGTATGCCCTCGTGATAATAGTTGTATCGAAG
CTGAGCCTTCGAGTAGTAGTTGGCAAAGTTCTGAACCGCACGCAACCGTGGAATCTCATTGACTTGTTAGTATTAGTGTGCCGGATCGTAGAACAGGTTG
TTTTTTTTTCAATACGTTCTCGACAGAGGATATTTGCACCGCATCAGCTCAATGTAGCTAATCATATGTCTTGCTTTTTGTATGCTGTGCTGGTTTGTGA
ACCGCACGGAACAGAGCAAATCCTCTATCTTGAGATGCGGAGGACGGATGTTATGCACTGTCATGGGCTTTGAACCTGTCAGCTTCACCAACGCAGTCGC
TCGAGCGGGTGCGTGAAGCGAGTCCATGCATGTCCGGCGAGGTGCCCGTGATGCAGGGCCGAGCGCTATTTGCCGAGCCAGGTCCGGCGACGTGCTCCTC
AATGGGACGAGCATTGAATTCACCAGGTGAGAGAATTCTTCCCCGCAGAAGCGGCCCTCTTTGAATTGCATTTCACCCCCTCCTCCTACCGGCTCTTGAC
ATGCTGTGCAAATACTATATGTCAAATAGACACTGTCAGGGAGCGGAGGCGCTTGACGATTCGTCGACGACGAACGCTGTTCATTCAAGACTTGAAGCCG
ACCAGATCCACCAGGCAGAACGGTTCTGCCAGAACCGAACAATCCGTACATGTGATCAGCGAAACATTTGCAATCCAAATGCCGAAATTGGATAGGTCCT
TTTGCACCACGCCATCTGCGGCAACAGAGGCTAGAGTCTGCCAGACTCAAGGGTGGCTGCCGTACATGTAGACCACCTTGATTGATTGAATAGCAATCGC
GACGATCACCATCCTAAGCACTGATATTTGAGAGAATAGTAAGCAGCGTTGCAAGCACTGAGATCAGTGTTTAAAATATAATTAATATACTATTTCTGAA
GCTTGACAGGATTCTTCAGCATTGCTTAGCTCAGTCCAGCTACTGGGGCTAAGAAGGTTGTCACGTACAAGACGTGAACAACAGCTTGTGTTCACTTTTG
AAGTTGCAGTACTTGTATAAATAAATGCAAACCCGCGCGGCACAGAAAGATGCCATGCAATCGTAAGTGCATGTACCAAAATCATCCGCCTCCAGCGCAA
GAGCAATTAGAGCCCTAAGACCGTCACTTCAACTAAAAGCGAAGAGGGAAAAGAGAAGCCGCTCCTTAACGAGGTACAGTACCCGACAGGGTCGTCAGGT
GGAGGTAGAAGAGGAGAAGGACTGAGAGGACGAAACCATGGAAGTTAGCCTCGTGTCGCGAACCCGGGGTATTCCTTTGAAGGAAAGTTTATTAATGATG
AAAAATGAAGCAAAGTGGAAACTGGGTAGGGCTAACTACTGTCCTCGACTCAGGTCTCGATACTGCTCTCGGCTCCCACCCCTCACATGGCGGACGTGTG
CCTTCGCCCACTGCTTTCTCGCGCTGCGTGCAGCGAGGCACGTCGCGTCTTGAGTCAATCGTCTTCTTAGCCGCAATTGGCAGCGCACACCGCGCTGTCG
AAACCAGTCCCCACCATAGGCCACAGTAGAAGACACGTCATAGCTCGACGCAACCACAGCTTGACACGTCAATCTGGCGACACTGCCTCCCCAAAGCTTG
GTCGTGTTGGGCTAGTTGAGTTGTTGTAGGAAGTCCGCATCACCACAAGTAGCGGCGTACTCACGGACCTTCGCAGGGACATCTTGGAGCAGAGTATCCA
AGGGTTCCCATGAATTTTCGATGGCTTGAAGTACAACCCACGCAACAAGCAGTTCCCAACGATCGAACTCCTCATTGAAACGGTGCTCCAGGAATCCGCT
CACGCCCACCACCATACCCTGACTGGATGCCAGCTCCAGGAGCTCATCAGTGGTGTTTAGCGTTGAGTCCGCGTAGAATTTCAATCGTGACGCGTGCACC
TCGTAGACACGTCCCGTGACCAGGTGCTCAATCTTGAAAGAGTGAGGCAACGCCTCGGTAACCTTGAAAGAGCCTACCCACTGACCCAGCAACTTGTTGT
TGGACAAACGCTGGTCGATTCTCGACCACAGCACAAAATCCCCGACATCGAAGTTCACTGGCGTGCCTTTGTGCGTCATCATGTCTTGAAGACTCTTGCG
TTCCTTGGCGTCAGTGACGTCACGGTGCATTTGGTGTAGTGACGCGCGCACATTCTCGAGTTGATCGCCCAAATCTCCAATTTCAATGACGCGCTCTTCA
GTGGTTTCGCTCGCTGGTGCAACCACCACGTCCAGTGCCGATGAAGCAGGGAGACCAGTAAAACCTTCAACTGGAGAGTGTCCCGCTAGTGACTGCACCG
CAGTATGGTCCAGATTCGCCTGCAGAGCTGGCAGCAAGTACGGACATTCGTGATAGTCCAAAGCATACTCCAACAGCAGTGCCCGCAGAACTTGAAGGAC
ATCTCTGTTGAGTCGTTCAACGGCCCCATTGAGCCAGGGAGAGTAGACAGGTGTGAAATTCTGCTCAACCTTGAGCCGAGCTGCCATGTGTCGCATCATC
TCGTTACGGAAATGAGCTCCTTGGTCCGAAAGCAACGTCTTCGGAATTCCGTACCGAGCCGCCCACATTAACAACGCTTCTGCTGCCACGTAGGCTGTCG
GCGTTGCACACGGAAACAATTCACAAAAATGTGAAAGACCGTTCTTAACCACAAGGAGGTATGCTGAGTCTCCATAACCTTCGCCATGACTTAAGAAGTC
CCAATGCACCACTTCATTGCGTTCCGTCGGAGTCAGCAACGGGCCATACGGGCGAGGAATCAGCCGCGAACCCTTCACATGCTTGTAGAGTAGGCACTGG
CGGACAAACTTGGCCACTTTGTCCTCCACTTTGGTGATGTAAAACCGCGCTTTCAGAGCCAACACCATTGCTTCCTGACCGCGATGACCCTGTGGCCCAC
AGTGTGCGATCACAAAAATTCGCGCGAGTAGATCCTTCGCTCCGGTTGGGATCCATGGAAGTCCACCGGCGACCAGCACGCCACTCTCCTCGGAAAGAGT
AGCTTGTAGTCGAGATTTCTCACGGGCAGTGTCTGCTTGGGCACTCGCAATGTTATCCCAGGTAGGAAACACAAAATCCGCGTCCATGAGCGGGCGAAGC
GCTGACAACTCGACCACGGGAACGACATGACGCCCTCGCGTTTGCACAGCAGCCACTGAAATGGATTCCGCTTCTCGTACGTGCCACCTCGACACGATGT
CTGCCCATACATTGTCGTCGCCCGATATGTGTTCGATCCGATAGTGGAGCCCACACAAGCGCATTGCCCATCGTTGCAGCCTGTCCCGAACGTGCTTCTT
CAACTCGTCATGAGGGGCGAATATGTAGATAAGGTTTGCGTGGTCGCAAAAAAGTCGAAATCCTTTTGGACGAAGAAGTAAGTACTCCAGATCGTTGCAT
GCCTTAACGATCGGATAGGCTTCCTTCTCGATGACAGTCCAGTTGAGCTGCGAACCCTTGAACATGCCACCTTTGCAAATAACCAATTGGTGATCCTGTT
GCTTGACTGCGACGCCAAATTGCCATTGGCGGACCTGGGTCACCACGATACTGAAACCGGAGAGTGATGCATCAGTGAACACGCACAAATCTGCGTCCTG
GTCTGGGTGGACCATCAGTGCAGAATCTCGCACCAGCGATACCACGTCTTTGAAGGCATCTCGTTCCTCGTTACTCCACTGAGTGGTAACCTGCAGTGCG
TTGCGGTTCCGCTTGCCAATCTTCTTCTTCTCGGCTTCCAACTTGGCATGGAGCGGTGCAATTACGCGGGCATAGTCTGGCAGTGAGTCATGTAGCCAGT
TTGTGGTGAACACAAAGCGCTGCAAGTCGGCGACTGTAGCGGGAAGGGGGAGCGTTGATAGCGCATCCATCCTCATCGGGTCATGTCGGACACCATCCGC
CGAGAAATACCGCCCGCACAAGAGGATCTCCAGCTCGAAAAGGGAACTCTTCTTCATGTTCACCTTCAAGTTCGCCTCTGCAACAATTGTAAAAAAACTT
GCGCAGCACTACCAGGAACTCAGCAACGGTCGGTGCAAACAAAATCACATCATCCACCCACACCAATGCCGAATGCGGGATGAGCGGAGCCAGGAGTGTC
TGCATTTGAGATTGGAAATGTAGCGCCGAGTCCATGGCGCCTTGAGGCACGCGATTGGGCGTGTAAACTCCATCCGGCGTCACAAATGAGAACAATTCCT
GGCAATCAGGATGTAAGGTGAGCTGCCAAAAGCCGTGAGTCAAATCGAATCTGGCGAACACACCTTCTTGCCAAGCAGTACTTCCATAACCGTAGCAGTT
GACGGCATCACCCCCGCAATCGGGGTGGTCAACCGGTTGACAGGGCGATAGTCGATGGTGAGGCGGAACTTATCGCGGGACCCAGGCTTCCGAACAGGGA
CAACTGCACAAGCCCAGCGCGCCGCGTTGTTCTTGGTCACCAAACCTTCCGCCACCAGAGACTTGACATACTCGCGAATAAACTCAGCCAGTAGTGGTGC
ATACTTGCGGGGAGGACTTCGATACGGCCTCGCATCTTCACGTAGCCTGACATACAGTGGCTCAACAGACGCCGCCGCACCAGAACTTACAGCATCGCGC
CAAATTTCGGGAAACAGCTCCAGCATCTCACGCACTGCTGTAGTGTGCTCATGGGGTAGACCGTTAGCAACCGCTCGATCCAGCAATTCATCCAATGTTG
TAATGGGGGTCGATGCATCCCCCAGGCAGCTCGTCACCCACTGGAAATTCCTCCTCCTCGTCTTCCAACAACGTCGAATCTGCCAATTGGGCCAGAGTCT
GGTCAACATCGATGCCCAAACGTTTCAAAGCGTCCTTGCCAAGCAAAAACTCGTCGCCTTCACCCTCCAATACAAGGCATGGCACGGCGCGTAGGTTGAC
AGCGTCTGCGATGGCCACGAGCTCGAGGTCCAATACTACCTCCATTTCGCAAACTTGCACGCTCCCATCAGCTAGTGTCACACTGACGGGGGAATCAAGG
GCACTATCCCAAGACCAGGTTGCACGGCACGCAGCGAGTCTGCCATCGCACTGGGGATCACGCTCTGGTCAGCGCCAGTGTCCGCAATGTACGCGACCTC
AAGAAGCCCGTTCACTCGCACCATGTTTCTCGTTGCTCCAGCGCGTACCGCCTTTGAGCGAACAGAGCCTGCACGCTGCTCCTTAGCGGCCTGATACTGC
TGACGCGCGGCTTCCTTCTGTGTGTTCGTCGCTGTGGGGCAGTCCATGGGCCAATGGGCGTCTCTACACACCAGGCAGCCGTCTTGTGGTGGCGGCCGAG
GGGGGTCGGGGTGTAGCCACAGCGCCACGAGGTGCTGTCGGCGCAGGAGCTGAAACACGGGAAGCTCCGTCTGTGGCGTTGGGTTTTGATGCCGAACTGT
CACGGTCCGGCTGATGTTGCACCTTTCAGTGAACGGCGACAGAACGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGA
CCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGGATCGTACCCTCGGCTGTGTAGAGCCGGCTATAC
GATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGA
AATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGG
GATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTC
GGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACC
CTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTC
AACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAG
CGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTG
TGTGTCTTGGTTGCATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTAC
CAGCAACGGCGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTC
GGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCC
GCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTT
ACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCC
GGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGG
ATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAAC
CCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGG
GGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGC
CCCAGAGGGTCGACCGAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGTATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGTACAG
AACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGACTC
ATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGGAATGACAGTG
CGACACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCG
AGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGA
CAGCTGCCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACT
ACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCG
TGATGCAAAGGACCACGTCGAGCACTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTC
GAGGATATGATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCG
ATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCG
TCGCCGGGATGACCCAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGG
AGGATACCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCG
GACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACA
ACCGTCGGCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATG
CGCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAA
GAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCC
AACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCT
GATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAG
ACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAG
AATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGAC
ACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTA
ACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGC
AGGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTG
CCCCTGGTGAAGTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGC
GAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACG
AGGGCAGCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTG
CCGCAAGGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGA
ACGCAAACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGAC
TTGGAACCTAGACGAGGGCCAGATAACGTTCGCGAATAGGGCACTGAGGAACCGACAGAACGAGACCGAATGCCGTTGACGACTTCGACCCTCTGACGAA
CCCGTTGGAGATAGATGGGTCGACGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCC
CAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTACCCGGGGGACGGTTCAGGTAGTGGAACACCGATA
CCAATACGTCCGAACATTTAGCGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACT
GGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCG
AGTGGGAATGCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCC
GACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGAGCGTCGCCCATCGTGATCGTGCT
CAAGAAGAATGGGGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTG
TTGACCGACCTGGAAGCCTACCTATGGTTCTGCTCGCTTGACGCGACCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCAT
TCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAGCGAATGATTGACAATGCTCTGTGGGG
TTTCGTCCAACCCAAAGGCTCCACTTCTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCACGGACAGGGGTGACCGACCCTTCATCGCGAC
GACTCGAGGAGTCAACAACTCGGTTGACCAAATTCGAGGCCAACCGCGAGTCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAACCCTGTGGC
CGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATCATATCTGTTTTGGGTCCGAGACTTTC
GACGCGTGCCTGGAGACGTTAGACCGTCTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGTCAAAGGTGG
ACTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGAT
GCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACG
CCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGG
TGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCT
CAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATC
CACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCT
GGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTT
ACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATG
GTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCT
CGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGAC
TCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGC
GGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGAC
CGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGC
TTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACC
AAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGAGCGGCGAGCGAGACGAAGCGAATGGTGTGACCACC
GAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGC
GCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGC
CAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAG
GAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAA
CGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCG
ACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGG
GGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCG
AGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGAT
GCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCA
GAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACC
TAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGA
AGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGA
CGTGAGAGAGCTGCAGTACCGAATGTCGATGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCTGATCCCACTGTCGAAGGACCGA
GGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAG
GATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCC
GTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCT
GGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAA
GTGAAGTGGATTGGGTATGATGAACCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGATTATCTGCGGACTCGGCGCAGCGAAC
GACGATTGCAGATGGTTCAAGTCGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGAGTGATACAGCCCGTAGCAACAGATGA
AATTTGCTACTGTATCAAAATTGCGAGTGACCGACTATTGATTGCTACCGAGCCTCTGACGAGGCCCGGTTGCGACGTCGGTTGACGAATGAACTGCCTG
CGGGGATGATGCAGCCCGCAGTGACAGACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACGTGAACGATTTTCGAATGGAATTGGATTAA
ATGGAATTACTTGGAGCTCAAGAACTGCCACTACGGAGGACTACGAGCTTCGGACGGCACACTGGCAGCTTGAGGAACGAACGGGAAAATTGGTGAGACC
AGACCGAAGCCTAGACCTCAGTGGTTGACGCAATGTTGGCCAAAACATCCAGATCCGACCCTTGAGCAGTTGCCGGCTCGTCGGCCGGTGCTGGGACCGA
GGAGTGACTTGGTGAAGACTCGGAGACGTCATCATCTTCCTCCTCCACGCCGGCTGACCAGTGACACCACTGACAGAAGCTTGGACAACCCATGGAGCCG
TCACCATAGCCGACGACAAGGATGGATCAACCATCAACCCGGACACCACCTCCGCTTGCGTCATTCCCCGCGGCACGAACAAAGGCACTTGGGGGTTACA
CGGAGCGAACGTGGTGTTGAACGGGTGGCTAGCCGGCGGGTCGACCCAACAATTGCGCCACGGCTGCCTGTCGTCCAACGTGGCGAGCTCTCC