Description :
From Genome Similarity Track
Location :
Scaffold_1345:67- 4817
Sequence
4750 bases(100 bases per row)
TTGGGCCTTTTCTTAGGGGGCGATCCCTAGTCAGCGCCTTCATCCCATATTAGCTCGAGGGAGTGATGCCTCGCGGCCCAAGACTCCCAGGGATCTCGTC
TTTCCCCTTTAGGAACAACTTCACAATCTCCAGCGTCCAAGGGCGAGAAGTAAAGCTGCCCACTGTCCCAAACGTCCTTTGTAACCCGGCCGACTTGAAC
AGCCAAGCTAGACGTAGAGTGTCGAAGTAAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCAC
CTTCTCCACCGCTCCGTAGTTCAGTTCGTTTGGCTTTAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAGGCTGCT
GAGACCGCCCAGTCCCTGGAATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATGGGTGTGGTCGCGATCCTGTTCCTCAGCTCCA
CGAATGCGTGTTGAGCTCGGATCCACCGAGGCTCTACCCTTTCCGAGTTCTGATCCGTGGTTTTTATCCCGATTGGATCCTCTTTCCTTTGGTCCCGGGG
TGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCTGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATC
CGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAAT
TCAGACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTT
GGAGACTCGATGGGCTAAGTCATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGAT
GTCACCCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTG
GCTCCCCCGCTTCGAATGGATCCACTTCCGTGTGATCTTCCCCGGATCCACCCTTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGAT
GAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAAAGCGGATATTGCGCGAGCT
CGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTTGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTAATTAGAGGCA
TCGGATACACCATCAATCGAGTCAGGCCGTTAACTAACCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGAGA
TGCCCACGGGGATGACGAGAAACTGATGATCTTGGCTTGCAGCATGCCCTTAATCAGATCTGATAGGTTTTCTCGGAACTGAGGCGCCACCTTCCGCACC
CTTTGTGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGGGGGCGGTAATGCATTACCTATACCAATCAGCAGATGTCGGC
TTTCCCAGATATTCTAACATATCCGTTCCACTTCCGCGGGCTCGTTTGCCCCTGGATTCACTTGGGATATCGTCAATCGTGTCCTCCTCTGTGGGCAGTG
GCACCTCCGGGATTAGCGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTAGTTCATCTTCCGTCTTCGTCGGATC
CACCATTGGATCCAAACACCGCGACCCTCTTTCACCTGGCAGTCCTTCTGTCTTCGTGGGATCTGGTACCCTGGTATCGGGGAAGCCACCAGTTGGATCT
AGTCGATCCTCTAGCGAGTTTAAACCCGACGGCGCTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTGCCCCATGAAAAGTTAGGAT
CCACTCTGGGGTCAGCGGGATGTGGCGGTCCGGCTTCAGCCTTCTGCGATCCTTCATCCACCGACCCTGTGTTATCTAAAGGCCGACTCTGGGGATCATC
CCCGGTCTTGGATCCAACCTCCATCGCTTGGACCTCAATCCGACGATCCCTCTGCAGTATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGG
CCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTTTTTGTAGCGGCGGGATCCCA
CTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGT
GACCTGGAGGTATTGCGATCGACCTGGTCCCTGGATTACGGTAGGCACCCATTTTTCGCCTCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAGC
CGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTATTATCTGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGA
GCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCTGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCATCTTG
ACCAGCGAGATCTCCAACCCAAATATTGAATTAGTACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTGCCATTCGTACGGTACACGCCTTCA
CCAATCCCCAACACAATCTCGGATCCGACTCCCATCCACTTGGCACCCAACCCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATC
TAGGAGTAGGATAGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGGCTCT
CCTGTTAGCAGATCCATGGATCCAATATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCT
CAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCAC
TTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTG
TTCACAAATGCATAAATGCAGTACCTAGAGCGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTCTAACATCTTCTCGGCCACTTCTGGCAA
CATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGA
CACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGC
ACTGCGAACACCTGACTTGGGCTGTCCCGTCCATGAGATCTCGAGATCTGTACATCCCACGGTCTCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCC
GGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTTGACGGTAATCTTCAGGGTCGGAGTCCGAAGCGTCGGATCCTGACTCAGTTCCTGAGTCG
GGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTT
TTGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTC
GATGAAGTGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCC
AGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATTTG
GCCACTTGTTCCTGGTGGATCTACCCAGCCGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCGACGC
TTGATCTCTCATGAGGGCCGACTTAACCTTGCTGATCCATGTTCTCGCTCGATCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCTGATATGGCT
GAGATCCGTACCCTCTGGATCATGGACGATCCACCCGCCCCGGCTTCGGCTGTTGCTACCACCGCTGACGAAGGGGATGGTCCATCCAGATCATCTGGGT
CGAACTCATCATGGGAGTGGTCTCCCTCCACTGACTATATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTGGCGCTTGTGGCACGGGCGCTCTCAT
ACCCTGTTCGGCCAGAAACCGACTCATCGCAGCTTCGAAGTGTTGCTGCA