Description :
From Genome Similarity Track
Location :
Scaffold_1862:67- 3331
Sequence
3264 bases(100 bases per row)
ACACGTGATCTACATGAAGTTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAG
GGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTC
ACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGAGCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAATGGTTCAGAC
AAGCCAAGGTAGGGGGCAAGTTCAACAATGAAAAAGCAATCCTACTCGTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGT
TGGGTGCCAGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGTGTGTACCGTACGAACGGATCAAGATCACGCTGGCAGGTTGTTTGGTATACTGGT
TCAATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCTTCGGGATCGATTTCATGGTACCAGCCAGAGTGAGGTTGGATCTGGCGGATGGGACACT
GTGTTTCCCCGACGAGATGCGGATGCAGCTCAGCGGACGGCGACCGTTGTACGAGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGAG
CCCGGAGAGACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACCGTGGGTCACTCGGGCGAGAAATGGGTGCCTACAGGAATCCAAGG
ACCAGGTCGATCGCAATACCTCCAGGTCACGAGCGTCAGCGACAAGAAACTATTACTGGACCATTATGAAGGGATCGGACGATGGTTGGCGAAGGACGGT
ATCCCTAGGCGGCCTGGATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATTGAATCTCTCGGGG
AGGGGGAGCTCCCGGCGGCGCCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGATCTTACAGAGGGATCGTCGGATTGAGGTCCA
AGCGATGGAGGTTGGATCCAAGACCGGGGATGATCCCCAGCGTCGGCCCCTAGATAACGCAGGGTCGGTGGATGAAGGATCGCAGAAGGCTGAAGCAGGA
CCGCCAGATCCCGCTGACCCCAGAGTGGATCCTAGCTTTCATAAGGCAAAGTGCCTGGATCCTTATCGAGAGTGGCGACACTAGTCCAACCAGAACCGTC
GGGTTTAAACTCGCTAGAGGATCGACTAGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCGGATCCCACGAAGACAGAAGGACTACCAGGTGAAAGA
GGGTCGCGGTGCTTGGATCCAATGGTGGATCCGACGAAGGCTGAAGATGAACAAGTCTGTTACCATGAAGGTGGGGATCTACACGCCGAGGATCTCGGAG
AAGGCCTGGCGGTGATCCTCGAAGTACCACTGACCACAGAGGAGGTCACGATTGACGACATCCAGGTTGATCCAGGGGCGAACGAACCCGCGGAAGTGGA
TCGGTTACGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCTGCGGAGTCAAATGTGACATCGATGTC
GGCGACGCGAAACCGATCGCTCAAAAGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCA
TCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGAGTGGATATACGTCTGTGTATTGATTACCGGCTAGTTAACGG
CCTGACCCGACGGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTAGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTAGACATGGCTAGTGGT
TTTTGGGTGGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATTCCGTTTGGATTGAAGA
ACGCACCCCAGATCTACCAACGCCTGATCGATAATGCCTCTATGGATTCACCCGAATACCGGAACCCGAAAAGGGTGGATCCGGGAAGGTCATACGGAAG
TGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACTTCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTG
GGATCAGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTG
GATTACTTAGGCCATCAAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGA
TGCAATCCTTCTTGGGCAGTTTGAACTACTACAGCCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGC
CGCGATGACCACTCCAGCTGTCCAGATAAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAG
GACCTGAAACAGGAGCTGGATCTACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGGCAGAATCTCGGT
GGATCCAAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGT
TTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAACGAA
CTGAACTACGGAGCGGTGGAGAAATAGATACTCGCGCTCCTGCGGGTGTTGGATCTAAATTACAACCTGCCGGTGGGAAGATCCATCTGGATCCTGACCC
GACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCGTTACTCTCGCCTTGGACACTGGAGATTGTAAA
ATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAG