Description :
From Genome Similarity Track
Location :
Scaffold_174:67- 1409
Transcript NameFunction/comments
Physo_144237hypothetical protein

Sequence
1342 bases(100 bases per row)
TCGCGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATTCGTTGGGGTTCAGACGACGTATCCGATACATGTTCCGCTGCGGAGACATAAGGTGAC
GACGATCGGTACCCAGTGGCCTCCACTCGCGGCGATGACACTGGAGCCGGCGACACCGGATCTGGCACCTTCGGGTCCGGACTGTCCGCGATCATGTCGA
CCAAAGGTCTCAACTTGTCGACCAATGTCTGAATCGCTGTCTGGATCACATCGAGATCTTGATCGAAAAGATCGTTCGCTTCAAAGGCGCCAGCCACGAA
GCCGGCTTCCTTCAACAGCCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTATCCGTCACTCGGCGGGCCGAGATCAGGCCCTTCGGGTCGTCGATCTGC
TCTGGCCGCACGATCACCATGACAGGATCTTGACGCAAGAAATCTCGCAGTTCCTTCAAGTAATACTGACGATCCAGGTCAGCCTCAGACCAGTCGAGCG
CCGACGGTCTGGGATCTTCGTCGTCCAAGCCTGGCGCTCTCAGCTTCTTCCTCACGATCTGGGTCTTGTCCGCGATCGCGTCCAGGTAGTCCGCATCGAG
CCTGGTCGGCGAGTCAGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCGCACCAAGATCCACCGGGGTCCCCGAA
GGGACCTGGGGAGGATGTTGAGGTTTGGCTTCTAGATCTGTCTCCAGATCACCCTCGATTCCGTCAACAGAAGTCCTCCGAGCACTCTGTCAATCCGCGG
ATCTCGTTTTGTTCAGCACCGTCTTCGTCGATCCGATATCCGACGACGCCTCTTCCCCTGGTTTTTTTCTTCACTTGCGCATCTTCTACGGACTCACGGT
GAAATCCGGAGTCCCCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCGC
CCAAACACCGACTAACGGAGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCAGCGGGCTGGATCTGCTCTCTCGG
GGCTCCGAAGATGCAGCACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGAGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTAT
ACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTTGCCTTTCCGGGTGTGTTCCTTCCTTTCCTGGGTTGC
TTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA