Description :
From Genome Similarity Track
Location :
Scaffold_1:67- 13339
Transcript NameFunction/comments
Phyag_g1hypothetical protein
Phyag_g2hypothetical protein
Phyag_g3conserved hypothetical protein
Phyag_g4elongation factor P, putative
Phyag_g5hypothetical protein PHYSODRAFT_554382
Phyag_g6U4/U6.U5 tri-snRNP-associated protein, putative

Sequence
13272 bases(100 bases per row)
CAGCCTCAGCGCTCGCCCGTTCGACTTGCTGCCGAATTGAAACACAAAATTTTCAGCCTGCCAAAACTAGGCGCCCTGCTGATCGATCGAGAAACCAGgg
ctgctgccagtgctcACAAACCCTGTGACGAAGCACACAAAATCGAAGTCCTCACCGGAGGCAAGTGTGTCGGACGAGTAAGCGCCGCCTCACGGAACAT
CCCGCCTTCGATTCGCTCGCGTCTCCATGCCTCTGCAAATGTGTcagtacgacgagaacgatTATACGACATACTCCGTCGAGACTACGACGATACGAGT
AAGCGCTGCACGCAGTAAACGACGCACCGACAAAGACTTGAATACTTCGACTGAGTTGAGGAGAGGTTTGTCATTGCATTGGAAAGAACGCATCATCTGT
CAGTCCTTCGAAGATATTTACGTTGCTGTCACCATACAGTGCTGAATCTAGTGACACGCTCGTGGACCCCACTCCACTTTGCTGTGAGTGCTGTTGAGGA
AGCTGACTCTGCTGATGAAAAGGCTGAGGCGTAGGCTGGAGATGCTGTGTCGGCAACGACTGCGGCATCATATTTTGCGCTGACGACGTTGGCATTCCCC
CATATCCAAAATTGTTCGGCATCAACGATGCTCCTTGTGCTCCAAAATTGCCTCCATTCATGGATCCCATcatctgttgctgctgcatagGCATGCCTGC
CATACCAGTCATAGGGAACCCAGTCGATCCGAAGCTTGCATCGGGGAATCCAAATGGAGTCATAAACGGATCCATCGGAAAGTTGTtactgctgctattg
ctgttGCCATTTCCACTGTCGGAGTGATtcactgctgctgacggcaTGCCGTAATTGTTGTTGCCATACATATTTCCTCCACCAGAAGATGCCAGGTTCA
TTGGCATGGGCATCAGCATaaactgctgctgttgggcGTTCATCATACCACCGCCCATCATGTAGTTCTGTTGATTCATAAATGCAGCGGATGAGCTAGG
AGGTCCACTTGTGGAAGTCATGTACGCGTTTGGCGTGTATGTCTGCACTCCTGAACTCATCGCGTATCCCTgagtcgacgtcgacacAGCCGAGGCAGcc
atcgacgtggtggaagtGAATCCAGTCGACGTCTGCATCAAGTTCATCTGGTTTGTTGGGAAGAACATACTCGAACTTGACGAAGTGTATCCAACCGTCG
GCATTGGGGGCTCCGGGAACATCGTGGGCGGCGATGATGCAGCCATATTCGGCATCGCCATCGACGCCGAAGTCGATACcgttgacgaagctgcagatcc
CATCGACGCCGTCATTGCCATCGGATTGCTACCAGCCAAGGTCGAAACCTGGTGAGGAGCGTAAGCCTGTTGAGGGGCTGTAGTAGTCGTCTGATGCTGT
GGGACCCGTGACACCGTAGCGCTCTGTCCTGTCAGCGTCGAGTTAtgtgctgtcgctgctccTCTCTCAGCTGAAACATTGGGTGAAACCCGCTGTCCTC
CCGTtttctcgtcctcctgaGCGATCTGCTTATCCGCCAGCGACGCCAACACCTCGAGCCTCGCCCCAACCTGCTGACGGAAGGTCAGACACCTCCGCAC
CCACTCCTTGTACTCAGCAGCGTTTGTCTTAGCAGCTAGAAAAAAAGTCATAGCAAAAGTAAATAAAAATTAGTTAACAACATTTTCTGCAGCATTCCGG
CGTTTTAGGAGGAcgtacgctgctgcttgtggagAGCATTCCAGCccttgagcgccgcctcgttcttctccagcatcgtctGGATCTCAAGCTGTGAAAT
GGAGCGCCCCGGAGCCAGCAGCGCCTAATACTCATAGTGTACGTTAAACTAAATGTAAAATGCTGCTATTTCTTGGCTGGTATTCGGTATATTTACCTGT
GCCGCGGCGgccgcgcgctgctgcagcgggttgGCGTGCTCCCTGTTAAAACGTATAAGACTCAGAGAATATGAGCGGGTGGAGGGCTGTTGAAAGCAGT
GGACGGAGCCACGTACGGcaccgaagacgacgccattgcagatggtgacgatggaggatTGAGGCGAGACGTCAAGTAGGAATTAGCTACGTAATAGAGA
ATAAAATGTAGCTATTACAGATGAGTTAAAACGTTTAATGAATGGCAGGTTTTGTTTTTAAGCGAATAGATAGCCAATCGAAAGCGAAACCTAGCCCTAT
AACAAGCTGAAGCAAAAGATGGTTCACTTACGTATCAACAACGATGGCAGGTCTCCTCTCCACGTGTGTGTCGGCGCCTGGCAAAGTGCTGCTTGTGGGT
GGGTATGTGGTGCTAGACGATCAATACTCTGGACTCGTGTTGTCCAGTACTGCGAGGTTTTACTCCCAAGTGGAGGCAAAGGTGAGATTGTATCAATTGT
GTCAATTGAGATGCTGTTGAAAAAAACTAAGTTTTTTATTATCATCTATAGCAGCCTTGGGGCGGAGACGACTCGGCATCTGCTGTTTCAATTGATTGGC
GTCGGCTGTTCCCATTGGCGGTGGAGAGTAAACAATTCGACCAGGTGATTGAAGGTTGGGTCGAAGAGAATGAAGCAGGGAGGCTCCGGTTCCAGCTCAG
GTGACGATGGAGTGCACAGTTTCACTGCAGTGGGGCTATTTTCTAACATTGGAGAAATGTGGGGACAGGGAGGACTCGCACCGGAATTCGTACATtgagg
agacgctgctgtgtGCAGTGAATGGAATTGCTGGattggacgagttcaagatAAATGATACATTCAGGAAACTAtcggagacgaagacgcgtGTGCATGT
CACGCTTCGGGGTGACAATGATTTCTACTCGCAAGTACAGAGGGTAACAAGACCTTAGATTATTGTGGTTGGATTCAATGCTGACATTTTTATTTTAATG
CTGCATTAGTTGCAAAATGCCAAGCTGCCACTTCGTCGCGCAAACTTGAAGACACTTGAGGAGTTTCTCCCTCCTACAATGGAAGGTAGAGGTGGCATTT
TTTTATTGTGTTGTGGAAAACTCTCTGATTGTTGTGTAGAGTGTGGTGGCAAATTGGTTGCGTTGAAGACAGGGATGGGGAGCTCTGCCGCTCTCGTGAC
GTCGCTTGTGGCGGCTCTGGTGGCTTTCTTTGTGCCTACGATGAGCttcgacaagcagcagaaggaccTAGAGCTGGTGCACAATTTGGCCCAGCTGAGC
CACTGCTACGTGCAACGCAAGGTGCGCTTTGTCGCTGCATGTAACGATCGAATGGCCCAGTAACATTTTGTTGCATTTACTGAACTACAGATCGGAAGTG
GCTTCGATGTCTCTGCGGCGTGTTTCGGATCACAGCGGTATACCCGTTTCCCAGCGACAATTTTGAACGCATTTACATCCGAAGACGCAATGGCCCCAGA
GGAGATTGCGAGCTGCATTACAGACAGCGCGCTGTGGAACAATGCTAGCCGCGTGGTAAAGCCAACTTCTCAATCTTTGTATTACAAGGGCTGTCGCTCT
AACTGGTATTTTGTCGATGTTGATAGAAGTCCGTTCGGTTGCCTTCATCTTTCCACTTGATGATGGGAGACGTGTCGTCCGGCTCGGCGACAGTGTCGAT
GGTTCGGCAGATGCTGAAGTGGCAAAAGGAGCAGCCTGAACAGGCCAAAAGAGTGATGGATGCAATTCATCGTTACAATTTGGAGGTCGAGCAAGGGTTT
GCTGACATCTGCGAGTTGGAAGCTAGTCACAGCAACCCCATTGACTGGGAAGCGTTGGCAGCGCAAGGCCGCGAGCAGGTAATTCTCCTGTGATCCTCTT
TAGTTCTTCTTTGACGAGCTCACCACTGTTTTGTTACTTGTGCGTGCAGTGGAGTACTATGGATGCTAAGATTGGGGCCATGCTTCTGCGAATCAGCGAC
GCGTTCTCTCATTTCCGAAGCTTGATGCGGTAAACTTACTTGATCATCCAACAGATTCCTTGCGATGGGAGTCTGATAATACGTGTGCTCTTTGTCATCA
TAGTGAAATGGGAAATTCCGCTAGAGTCCCAATTGAGCCGCCGGAGCAGACAACTATCCTCGATGCAACGCTGGCGATTCCCGGTgttcttctcgctgga
gTACCTGGAGGTACGCTCTTCAATTGAGTTGAGCTTGGTGCGTGCTTTTATGCTGACAACAGCTTGTTACTGTCTTCAGCGGGTGGATACGACGCGATTT
GCGTGATCGTGATTCATGAACGTGCTCTCGAAGCGGTTGAAGACCTGTGGATACAGTGGCCTACTACTCACCCTGACTCCATGTATGCCTCTCAAACAAT
GCACGCATTGTGTATACATAATATCTGACGGTGATGTGTGTTGTGTTGTCTCCTGAAGCATTTGCCCGTTGATGTGCGACATCGACCGTGGCTTGACGGG
TTCTTCGGCTGTGAAATCTGGGCTTCAACTTCACCCCGTTGAGTAGTTTTGTGCTTACCATCGTTCATCCATGTGGTATGGAACTAGACTAACACGTACC
TTAGTGCATAgagtccaagtcgtcgttAAATGCCCGAAAGAGGGCGACGCATAACCAAAATCTTTGCCTTCAATCTTCCGCCAGGGGTCACGAGTCGAGT
ATGCAGAATCTGTCAAAGCGGAAGGTCCGTGATGAGGGTGACATTGAGGAAGGAAGAATGCTGAAAGCAAATCACCTGTTGCGTAGCGAGGAAAAAGCTG
CGCAAGCGAAGATGTTAGAGCAGGACCAGCATGGAGAGTTCTCAATTCCTGGACTTCGGTTTGCGACTGAGTCGTGGGCTGGTCTGAAGACAAGCAATGA
GGATCGCCACGCTTCCTCCGTTGAGTTATTTCCTGGACCTGTGCTTGGCATTTTTGACGGCCATGGAGGAACGTTTTCGGCGGACTTTTTGTCCCGGCAG
CTAGTGAAGACTGTCTCCTCAACGATATGTCAAAATGTTGGAGGAATAGTGCTCGCTGATCTGCAACGTTCTCGATATCTTTCGAGCCAAGAGAACACCC
GCAAGAATGCTATTATGGAACAAGTTTCATTgctgcgccagcagcttgcagaGCTCGAAGCCATGCAACCAGACTCCGAGATTCGTAAACCAGATAATAT
TGCGGACGCTTCCGATGAAGTGGATACTCTGCTCTCGGATGCCATATCGCAATTGGACGGTGAGTTAGGCCAAATCGGTGTCGAGGAAGCAGCGCGACGA
GTGAGGCGAAAGAAGTGGTGTTATGAAGAGCACAAAAAAATTGTGACTGCATTCAAGGATGCCTTTGAGCGAGTCGATTCACAAATCTTGCAGAAAAACC
CGTCGCAGGATGGCTCGACAGCTCTTTTGGTTTGGTTCTTAGCGGATACGCTTAGCATTTGCGACGAAATGGGCACCAAGAATGACACTGCAGACAATGA
ACAACAAGCGGGCGAGCTGAGCTTCTATACGGCGAATGTTGGTGACTGTCGTGCCGTTATGTGTCGTGGCGGTCGGGGTGATCCGCTCACTAGTGACCAC
AAACCCGATCGCCCCGACGAAAAGCAGCGAATCGAAAAAGCTGGCGGTTTTGTGGGGAAGATTGCAGGCATATCTCGAGTATACTCTGCGGCGGGTGCTG
GGTTGGCCATGCAACGTGAAGCGTCTACGTATCTGGCTGTGTCTCGTGCATTTGGCGACCGATCTTTGAAAACCCCAACGCCACTCGTTTCGTGTGAGCC
AGAAGTAAAGCGGTTCACAGTGCAAGCGGATGACTTGTTTCTCGTATTGGCCTGCGATGGAGTCTGGGACGTACTAAACGAGCAAGATGCCGTGGATATC
GCTCTACCACATTTCCACGATGCAAAAGCTGCCGCTGAGGCGATCGTCAAGGCTGCCTACAGGAAAGGGAGTGTTGATAACCTGACAGCCACGGTCGTTC
AGTTCGGCTGGAAGTCCGATGCACAGGTTCAGCAGGCTCACGAGCGCACCAAGGCGTCCAAACCAAGTATTCCGAAAGGGAAAAACGCCATTGGAGCTGT
CGATGATGGTTCTGAAGAGGAGATCGACATGTTCAACCTGTGAAATATGTGCCTTCAACGTGATATCCTTCACCGTTTTCCTTAGTTTGGTTAGTATCCT
TGTTCGTGCGAGGCGATGAGATTCCGCTGTTGAAGgttcttcatgaagatgaaAATGTGTTTAAGACGatagcagcaatggcaattGTACAAGACAACGC
ACCTCGGCAATTGGTGTCATTGTATCCGCATCGAACACTCGGAAACGTACAGGCGGCGTAGGCGGTCGATCTCTTCGCTTGtgtttgcgctgctcgagtg
cCAGTTGCAGATCCACGAAAACTTCAGCCTCTGCTCAAAAGCAGCCGTGAAAACTCAAGCACAAAACATGAAATGTAGTAGTATGCAGTCCGTACCCACA
CGTGGGATGGCGAATCCTCCATTGATCACCATCGCGTGAAGCTTGATCGCTGAATGTTGTGGTGGAGCGATACGGATCACACGGTACTTGGTGTCCAAAT
GCTGGTGCAGGAACCCTACGACAGTCTCAAACTACGATGAAAGCGTGGCGTCAGAGGACATCGGATTCACTTTCCAGAGCGCAGAAGGTCAACCTACATC
CTGCTCGATATCTGCCCCACGCCGTCCACGCTCGCCTTCTAGTCGTGACAAGCGGTACGTAGCAAGCAAGATGGCTACGAGGATCACTGCAAAAGAGATC
GAGCACACATCAGTCGCGGCGATCATCCATGGCACAGTGCTTCTTCCCTACCCAGCGCACGCATTCGCAACGAGTCCAGCATGGTCGTGCTTTAACTGGA
GCCGACTTTAAAACAGACTTTCGTCCGCGGCGGTCGTGAGCAGAATCAGTGCGCGGAGAGAGATCTCCTTCGCTTGTGAACGCAGTAcgacacgtcgtcg
acagtGGTGTCAAGTGTATCGAAGTGTTATCGCGGATGAGGCGTCACCTTCTCTGCCGGTAGCGGCACGTGGAGACTGTTCCGGAGCGTGTGGCTGCCAC
GCGCTCAAGATATTTTTTCGCATGAGGATCGACCTCCATTGACGATACCAAACCAGGTCGGCCCCCTTGGTCGGCTCGTGTTGAGCTTGACCTCGGAcag
tggtgctggagacgatCCAATACGCAGCTTTCAATGCAATGCAGGACAAGTTGCTCTGTTGGGGCGGTATGAACGTCAAGGTAGATAATATATACATTTG
CCAATTAGGTGGGATGGATAGTAGCGACAAGGAGGCTTTCGCCACGCAGCggttcctcctccagtcgcGTCAACGTCTTACACCTTGTCTGTGCTAtggt
cttcgtcgctcgtgACGGGCTTTTGGCCTACGAACGCCATCGGCTTAAGTGCGTGTCGGTCCATGAGCATTTGCGCGACGTTGGCCGGTTCGGTGGACTC
CCCGTCCGTCTGTGGAGTCAACTGGGCACGCTGCACCTGCAAGGCCCAATCGGCCGagtcgaagcgctgcagacgcagacaccggagctgctcgcggtTC
TCGGCACTGCCGGGCTCAGGCTCCTGCTCCGATTCGGTGCCGTCCGACGCGCACTTGCCACATGTGCAGCCGGCGCAAGTGCCTGCAGTCCGTTGTGCCA
TCTCGTAGTCGGCCGAGTCGAAGCGCTGGCGGTTGTCGCGGTGACGCTGGATGATGGTGGAGGCCACTGCATGGGGGCAGTCGCCAGTAGGCGCGTGCTG
GTGATCGGCCGAGGGCGGCGCCACTTTCTCGGTGGAGTTGGCCATTGCTGAGTGAGTTAGTTGATTGAAGCTGTTGCGGGGGACTGAGCCAAAGGATGAA
TGACGAGCGTTGTCAGCCGCGCACCGCGACGCAGTACCGTAAAAGGTCGTGAGAGTCCCTCGGAGCTGTGCCCAACCAGTCgtgtcgtcgatggagctgc
tgtgtgGACGTTGGCTTTTCTCACCCAGGGCTCACCAAAGCCAGGCAGGCTGAAGGCGGTGCTTCAAGTCTTCGAGGCCTTGCTTGCTTTGCTTCGAGTC
GCAGCGCAATATCCCCCACCGTCCTGGGTCAGATTTTTGGTGCGAAACCGCTAGGCGAAGGTGTCTACATCATGATCTTCAACGATTGGCATCGCGGCAC
GAGGACGTGATGACACCTTTTGCAGTTACAGCAAGCGCCTTCGCCGAAGCAGGCCAGAACACCTCAACGCACTGCATCTGCTAATGCGTGCGCTCATTTA
TCTTGATGAGCACGCTCCGAGTCGGTCAGGAACCTGTCATGTATGCAGTGGCAAAGAGGTGTCGTCAATCAGGCCAAACGTTGTCCTCGAGGACGCGTCA
TGTTGAGGGGCTCATCTGCGCCATTAAGTCGGCGCCACTCTACAGCTTGTCGACGTACGCGCCGTCCTCCGTGTTCACCTTGACCTTGTTGCCGACCTCG
ATGAACAGTGGTACCTTGACCACAGCGccgttctccagcgtcgcgtcCTTGACGCTCAATGCCGTGTCCGCCACGCCCTTGGCAGTGGTTTTCTGCGAGA
AATAACGGCATTAATCAGAGCCAGACCTCCGACCAGAGAAATGGACCACGAACTGCACGCACCGTCACTTCGAGCGTAACGTACTCGGGCATGTTGGCCC
ACAGCACGTCGCCCTCGACgatctgcagcgacagcgtcatGCCCTCCTGCAAAAACTCCAGCTGCCGACCCGAGAACAGGTCgcgctcgatctccatctA
CAGCGACACCGGCAGCGATGGATTAATTTCTCTACTAGAttgtccagcttcaacgacactaaagcacagcagcagtcccGCACCTGCTCGAACGTCCCGT
TGTGCATGATGACGAGGTGGTCTCCGTTGTAGTAGAGGAACTGGAACGGCTCATCCGGACCCAGCGGCGCCTTGTTCACACTCTCAGCAGCACGGAAGCG
GCGGTTCATCTTGGCTCCGGTCTTtatctccttcagctccgccTAACAGCGGCAATTTGACATTGATACACGCTTCTGGTAAGCTGTTTATCCGATTATT
TTGCGTGGATTTCCACGGACAAAGTATACACCTGGACGTAAGCTCCGCCCTTCCCAGGTTTCACGTGCTGATTCTTGCCCACGCGGTAGATTTTGCCGTC
GATCTCAAGTGCCATACCCGCTCGCACCTGATTACCTGTTCAATTGAGTCAATTCGATGAGTTAAACGGTGAAACTGATATGAGAAAAGAGCGCGTCGGG
TGCTGAGCAGGATGGTACCATTGATCGTGGCAAAGCGCACTCCGCAGCCACGAGAAGGCGCCGTCGTCCGCGCAACGTGCGTGATTGCTCGACGCAGCAT
GTTGTATCCTAAAGTGTATGGGATTTAGCACCGCTCGTTTTTAACGCTGTGCCATTGGTCAATAATCGGATTAAAATCGCTGTGGATTACCCAAACTGGG
TACTGTACCCAAAATGTCATTCTTCAATATCCCGTATCGCTGGCCATGTTCCTGTGGCGAGCTCGTCGACCCGAGGACGAGATTCAGAAGGCCATCGAGG
CGGCCGTAGCGGCGGATAAAGCAGGGAAATACCCAGAGGCAGTGGAGCTATATGCGTCGGgcatcgagaagatgatggcgcAGCTGCCGCGTACGTTGAA
GCGGACACTATCCACCTGAAACGACTTGTTTCTTAATTATGTGCAACTGCAGAGCTACCGacggacgaggccaagacgcagatgcGGCAGAAGATCAATG
AGTACATGATGCGGGCCGAGTATCTGAAGGAGTGGATGGcggagcagaagcgcaaacAGACGCAGGTGCCTAAGAGAAAAGGAAAAAAGGATGAAATGCT
CGCGATTTAGCTCATAATGCGAGCGGTTTTGTGTATTTGTAGGGTGCACAGGAGAGCAATGATCACACTGCGAGTGGCCGACAGAAGCAGAGAGCGGCCT
ATTCGAAGCAGCATGCGGAGCATGCGCATACGATATTGGATGAAGTGCTGGACCACTCGCCAGGGGTTCATTGGACGGATATTGCCGGGTTGGCAGTTGC
GAAGCAGATTCTGCAGGTACTGTGTGCTATTGCTGTTTGCATGCTGCTAAATAGTTATGTGAGACTAACAGTGCATGTGATTGTTGAGTAGGAGGCTGTC
ATTTTGCCTACACTTCGCCCAGATTTATTCACGGGGCTGCGAGCCCCGCCTCGCGGTGTTCTGCTTTTTGGGCCACCAGGCACAGGTGATGAAATTGCAC
AGCTACTACAgtgctggacgaagtggaaACAAGTTTGTGTGCAGTGTACTGACGTTGCTTCAATTGGTGCGATCGATTAGGTAAAACGCTGCTGGCGAAA
GCTGTCGCTACGGAAGCGAACGCAACTTTTTTCAAGTATGTCTGTGGTTGAATATGCTTGCTTGGTTCCGATGCATTTTTCTtacgcagcttcttgcagt
aTTTCAGCGTCATCGTTGACGTCCAAGTGGGTGGGCGAAGGCGAGAAGTTGGTTCGAGCGCTTTTCGAGATGGCTCGAGAACTTCAGCCTTCTGTGGTTT
TTATGGATGAGATCGACGCTTTGCTCTCCACGAGGTCTGCGTCCGAGAACGACGCAAGCCGAAGAATCAAAAACCAGGTACAACACCATCGGCATGCAAT
GTGGCAGAGCAGGTTGGCTAACACGATGTGCTACTGCAGTTTTTCACAGAgctcgatggagctgcatcaTCACAGGAGGATCGAATCCTTGTCATGGGAG
CTACCAATCTTccgcaggagctggacgaggccattGTCCGTCGCCTGGAGAAGCGCATTTATGGTTCGTGCTTTTCTTTCGACCGGCTAAATGCGATACT
GGACGAGAAGTGTTTGACTGTGCTTTGGTTGTTGACAGTGCCTCTCCCAgatccttcttctcgtgaAGGACTTATCCGTCACCTGCTTGGCAATCAGAAG
TTCTCCTTGTCATCCAAAAATCTCAAGTACATCGTGAAGGCTACCGAGGGATATTCCGGCAGCGATCTCAAGGCGGTATGCAAGGATGCTGCTCTGGGCC
CAATACGTGAGCTTGGAGCGAAAGTAGCTAACGTGAGGGCCGAAGACGTGCGAGGTATCAACGCATCCGATTTTCAGGTGGCGCTCACAAGGGTCCGGCC
AAGCGTGTCGTCAACAACAATAGATGCCTTGATCGCGTGGAACGAACAATATGGAGTGTCTGCCGTATGATGAGCGCGCACATTCAAGGGCTGTATTTTC
AAAGGGGTTTACGCCTTCCGCTCGTATATCATCAAGTACGACTCGGACACACCGATCAGCTGGGGCATCGTTTCCTGGACGTGCAGGTCTTGGATTTCGT
ACCACTGCTCCGTTGCCTGTGATAAATAAATTCGTGATTACACAGTACTGCGTCAGTGCGATGTTGTTCCCGTGCATTGATACTTCAAACCACGTACTCT
ATTctggacgtggacgcgaTAGCTGCCTTCCGTCAGGGGGTTTGTCTGAAGCGCTGCCTCTTGCCCAGTAGTTACAGGACTGTCGTGGCAGATATTGGCG
ATTAAGTTGTACCTGATGCGATCAGACAGCAAATGTCAGCACTCTTTTGCATTTTCACCAGATCGTAGCCCAATCGCCGTTTGCACTTACTTAGTTGATG
GCAGCGTAACGCGCAAAATCTTCTCGACTAAATCGGACTTTTCAACGCAATCCTGTTGCCACAAACCACATATCCAAGCCATTTAAATTCTGTACGCATT
TGCCTCGTAGTAAAACCAAGAAGCAGTAATCTCACCTCGCTCGACTGATTGTGCTTGCGCAAAAGAGCTCGCAATTCGGAGATTGACTTATTGCGAAGCT
CGTCCTCCGACGGGAGGCTTTGGTCCAGCTTCAGGTAGTCACGCAGCTCCAGGTTCTTCACGGGGAAATTGACAATCGTCGGATTCttctcgatgaagaa
gttgttTCGCGTGAAACGCTTCACGTGGAAAATAAGGTACGCAGGTAGACGGTCGATCCggtacgtcttcttcagtcggTGGGAACCTTTAAGCACATGC
GTAACATGGGAGCCATTGTACTTCTCAAGCACTGTGAACAACGGGATCTACTCCAACAGCGATAAAAAAGTTAGTTTGACTGCCATATGCACGTGCAGAT
GGTTCTTGTGAGTGTACCTGAGGAATGATATTTCCTCCTTGAGAGTCCTTGAACAGCGGTGTCGAAGGCAAGTCCAGCGCCATCATCCTACAAACGCAGC
AGTACGTTTAGAGCTGGCCACAGATGAAACTTGGGATCGAATAAACTTACAAGCACGGTGACACAGTAGTGGTGACTGCTGATTCACGCTCCGCAACATC
CGCCGACGCAGCTTTCGTCTCATCAtccgtcgtcacctccacgaAACCCTGGAAACACGTGTGGATGATACTACTTCCGGGCTTATTCGATCCACCAAGT
CCCTGCAACCGCAGCACATTAACCAACCTTAGTCTCAACAGCACAAAGTCGCAGCTTTATCGTCTGTCACCTTACCCTGTgcaactcgttcagcagccac
gccaagagctccacgCTTTCATTCTGTGTTCCAACATGGAatctcttcttgctgctcactGAGATCTCTTGCACCAGCTCGTGTGGACTTATCTGCACCA
TCCCAACCACAGCAGTCAGCTCAGCTACAAACTCCCCATCAAAACCAGCCAGCCAACCGTCACGCACCGTGTTCTTAAAGTTGTGCGGACTCCACATCTT
CCGCAGCAGTTCTCCAAAACGCAGCACGAGTTTCGACTTGATCTTCCCCATTTTATTGCTCAGAAAGAAATCCCTCAGTGGCGGCACATGagccagcgcc
tgcaccaccacgttgATGTAATCTGTGTGCTTCAGATTGTTTAGGCCAATGAATCCTGGCAGATACGAGACGCCGAACGCGTCCTGCGCTAGGATGCGGT
TCCCATCCAGCCTGGCGATCTCTGCACCTTCAAAGCTCGGACGGAGCGCGTCCTGCACGGGCTTGAGCGTgttgtccaccacctcgtaGTTGTCCGGCAG
ACAGTAGATCCTGTCCGTCTGCAGGTTGATGAACACGTGGTGGCTGCTCTGCACCGAGTGCGTGAAGGCGTGCGTGTTGCGGCCGCGGCCCTTGAAGTAC
TTGCCGCAGACTAGGCAGGCGTAGACGTTCTGGTCCGAGAGGCTGATGGAGCACAccttctcgaagtcgaagtccagcagctggtGGTTGATCGTGTCCA
GGTACGGGCACTTGCGGCGCTTAGCGGAggagccatcgccatcgcccTCAACCTCGGAcgccttgcgcttgg