Description :
From Genome Similarity Track
Location :
Scaffold_3481:67- 1218
Transcript NameFunction/comments
Phyag_g13270hypothetical protein

Sequence
1151 bases(100 bases per row)
ACAGAAGGAGGCGTCAGCCCCTTCTCGCGTTGAGTCACTGAAGGTGTCAGTGACTCCGTTCTCGGGTGGCCAGAACGAGCCTCTTCTACGATGGCTCGTA
GAACTGGAgacagcaattgctgctcgaCGGATCCGGGATCCGTCGCTCCAAGTTGCGTACGCCATGTCGTGTCTGACTGGACGAGCCAGACACTGGGCGT
ACGGAAGACGTCTTACGGACAGTACGTGCTGGAGCACGTACGAAGACTTCAAGCGCGAGCTCAAGCTAGCGTTTGAGCCGCCTGAATCCGAGTTCAGGTC
GAGGGCGGAGTTCCTCGACCTGCGTCAAGGCAAGCGCGACGTGTTGGCTTACGCCCAACACGCGAGGTACTTGGTGTCGAGTATCGTCAATCATCCGATT
GACGAGGCGACACAAGTAGTCACCTTCATNACGTCGTATCGTGCCAACGTGGATCGTTGGCGCGGACGACCAAAAAACGCTGGAAGCCAGTAGGGGCGGG
GCGCCCTACTGGTGTAGTCACACATGCCGATGTCGGGCATGTGACGGCTACAGCCCCTTGTGGTGCCGGACACCACAGCAAGCGTCAGGATGATCAAGCA
GGGCTGATCATCCTGGAAGTCGCGGTGCATGGGAGAACCATGCACGCGCTAGTCGATTCGGGTGCATCGAACAACTTTGTTCGACTGCAAAGCCTGAGGG
CTATGAAcgccgaggagaagacgactCCTCGAAGTGAGTTGGTGGTGCGCCTGGCGACAGGNGCAGGGCTGATCACCCTGGAAGTCGCGGTGCATGGGAG
GCCCATGCACGCGCTGGTCGACTCAGGCGTATCGAACAACTTTGTTCGACTGCAAAGCCTGAGGGCTATGAacgccgaggagaaggaatCTCCTCGAAGT
GAGTTGGTGGTGCGCCTGGCGACAGGAGCAACCGTGAAAACGCGCAAGCGAACTGTATCAGTTCGCTTTGGCTGTGAAGGCCGGGCCTTCACTGAGGACT
TTATCGTCCTGGATCTAGACGATAAGTTCGACATGATACTGGGCATGCCGTGGCTCAAACGCCATGCCCCAGTGATAGACTGGAAGTCCCAGTCTATAGT
CTCTTACGGCTTCGAGGACGCATGCGTCCTCGATTCGGCAGATAGCGCGAC