Description :
From Genome Similarity Track
Location :
Scaffold_4024:67- 1194
Sequence
1127 bases(100 bases per row)
CTAGCTCGAGGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGT
TTTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGGTATTTGATGCAGGAAGTCGCGTAAAGCTTG
GTGGCGATACACAAACTCGAGATCCTTGTCAGACCAGCTGGACCTGGATCCAGCTTGACCTGGATCCAGCTTGGTCTTCTTTCGACTCTGGAGCTTGCAT
CTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGTTGTTGGCTTAACCGGTGAATCTGCA
AATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGA
GAGGTTTTTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTT
CGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTAAAATCCCGAGTCACCAAAAGATCCG
GGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGATATTGCCAGATTCAACTTACCAACTGCGCCCAGACACCGGCTAACGGAGGGGGTC
CCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTTGGTAACTTCCGAAGAGTTCAAGTGGTG
AAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGTAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTC
GAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTTGCGTTCCTTTGCGTCGTACTTGCCGCCT
CCTGTGACGGGATCTTGAGAGTTGAGA