Description :
From Genome Similarity Track
Location :
Scaffold_1878:67- 1084
Sequence
1017 bases(100 bases per row)
AGGTATGGCTTCAACCGCCCGACGTAAAAGGTCGGGTGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGA
ACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGTAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTT
GAATTCATTAGGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTC
TGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCTCTG
CACAGACCCGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGCTTC
TTGTTCTTCTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAG
GAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCGTTCATGAGAACGGTGTTTGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCG
AACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGT
CCGTCTGCGGATTGTCCGCAGTCGACATCGAAAGTTGACTCCTAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATACGA
CACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGT
ACCATCTTGCTGAAGCG