Description :
From Genome Similarity Track
Location :
Scaffold_10:66990- 89256
Transcript NameFunction/comments
Physo_130063hypothetical protein
Physo_130064hypothetical protein
Physo_112758PREDICTED: similar to ATP-binding cassette, sub-family A member 3
Physo_130065ABC transporter family protein
Physo_108444putative endo-1,3-beta-glucanase
Physo_130067predicted protein
Physo_155994tryptophan synthase
Physo_155995hypothetical protein
Physo_112767ATRAD54/CHR25 (ARABIDOPSIS HOMOLOG OF RAD54); ATP binding / DNA binding / helicase
Physo_155998hypothetical protein

Sequence
22266 bases(100 bases per row)
AAATTAAATAGATTTGAACAATAATTGTGCCTTGACACACGTCGCAGACTTTTGGAGGACCACTTTTTCTTTCAGACGTCCACCTGGTCCTCGTGGTTGC
TGGGGTGGTACTGCGCATTGGAGAAGTCTGGTGATGAGACGACCGTGGGGAATTCTGGTGGCTGGAAGCTGAACGCGCCTTGCAGATGCGGTGGCATCGG
CTCCATGCTCGGAGGAGGCAGCAACGGCGGCCCAAATGGCATCGGCGGCCCTGGGTTGAAGTAGTACCGCGACGGCGGGGGCCCTGAAGGTGCTGGCAAG
AAGTGCGGAGCTTGGAACCTTGAGTACGCGTCGCCATTGCCCGGTGAAAAGTACCGCACCACTTCTTTCGGTGCTGTTCTCCATAACGTGGACTCGCTCC
AGGGAAGATTGACCGCGGGGTCTGGTAGCTCGCGTTGCCTCGTGAAGTCCCAGCCAAAGAGCGACGACGTGGACGCATAGACCTGTTGTAGCTGCCATTC
GAGCTTGGCGTCTTCTTCACGGCGGCGCTGTTTTCTCCACCGACGACGTTCACGATCGTGCACACTCTCGACTACTTCTTCGTCGTCGGAATCCCCACCG
ACGCTTCTGCTGTCAAAGGCGATGCTGGTGTCACTGATGACATCTTCCAACGGGACGCTGATAACGTACTCGTCAAACTTCCTCTTGCCAGCAAAAGCCG
TTCGCGTGGTGAAGTCTTCGGCTGATGCGAATGATTCTTGAGGTTGAAACACCAGCGCGTTGGGGTTTAATCCAGACAACTTCTTCGAGGGGGGCTCTGC
TTCTGAAGCGGGTACTTCTTCGTCTGCGTCCAGTGCAGGCTCGTCGAGCGGTGCAGTCGACGAATTTGACTGACAATCACTGTCTAGAGAGGCTGACGTG
GACTCAGGCATCGGCTCTGAGACGGGTTCTTCCTCCGGAACCTCAACACCCAAGCAATCTGCCTCGGGCCTATCCATTACGTCGTTCTTGGGAGGCTCGG
GAGCTGAAGCAGCATGCATCGCTGATTTCTTCTTCTTTTTCTTCTTGTTTTTCTTTTTGCTGCTAGAAGTCGAGCTGCCTGCAGTCGTTTTGTCTTCTAG
GGAAACCTCCAGCAGTAGCTGCTCCATTTGTTGAGCTGCCTCTTTCTCCAAGTAGCTGACATAGCTTCGTAGGATTAGCTTTTCAAAACAAAAAGCAGTC
ACCAAACAAAAGGTTAGTAACGTTCGAGTAACAACACGATACAATCGAGCGTACCTGCTCCACTAGCATCCCAATCAGGCGTTGATAGTTTGTCCACGTA
TTGATGGTTTCGCTTTCGGTCACGAACAGTTTGTTGAAGTTACTCTCTGTGAGTACATGGATCGACGTTAAGAAGCCTGCCAGCACTTCCCCCACCAGCG
TGAAGAGTCGATCTGTGTCTTCGGCCAGCTCCGTCTTCACCGTCAGAATGCCTGTGACAGCATGCAACACCAGTAAATAAAAACGCTTTAGTGACCTACA
GGAGGTACTAACGCTACGCACCTGTTCCTATATCCATAAACTCCATCGCTTCCAGCAGCTCGTATGTCCTCTCTGACGACGTATCTGTGACTGCACGCGT
TTGCGACGGCGTGGCTGTTCGCTCTTGTACCGCCGGAATAGCATCAGCACCCACAGGTTTTGGCGCTGTTGCCCCTGTTGCTGTTGCCACCGTTGCAGCC
GCTTTCTTGTTGGCGGCCGACGTATCTGTAGCTGTTCGGTTCGTTGTCTTGAGGTGGCGCTGCATCAGCCCGACACACAACAAGCTCAAGTTGAGCTTGT
ACAGCTGCTTCACGAGCTCCGGCTCGTCCAAAAACAATATCTGCTGACGCTCATTTACACTGAGCTGCTCCCAATACTGCCGGACGCTCTTCAGCACATT
GGCCCCGTCGTCTTCATCTCCATGGCCGCTGCGTCGCGTGGTTGTCAATGGCGTGGCCAGTGACATCCAAATAGCTGGTCCAGGTCCATTCGCTCCTGCT
CGAGCAACTGAAGGCTTCGCTCGCTTCCGACCGCGAGAAATGCCATTGCCAGCGCTCTTCTTCGCGTGATCCAGAGCGTCGGCAGCTTCACTGGCGCTGG
GCGAGCGGATGGCCAAGTACGATTTCCAGATTGGCGCTGCGTCAGCGAAGCAGGCAACAACCACAATGCGCGGCACTGCAATTAGCACGTCATGTGATAT
CTACTCAACCGGCTGAGGTGGTCACGCACCATCCGCGGTCGACGCGGCCTTCTTGACGGCGGAAACGTTGCCTCGGGTCATCGACGTCATGACGATGATT
CGCACTTGCTGATCCTTCAGCCAACGTTTCACAGTTACTTCCCGGACTACAACAACCCGACATGGATACATACTATTGTACGCCTGGTAGTCAATACACC
TTTTTATTTTCGGACAACAATTTCAATTATTTTCGAGCACTAATTTCGGATCGATTCCAGCAGTCATTATTGTTCTGAGCACGACAATGGCGGACATCCA
GCACAAGCGCGTGGCGATGAAGCTCAAGCAGGCGTGCGAGGAGACCGCGGCGCAGGCCATCGCGGCCACCACCGCCAGTGGCCAGGCGAGTCGCATCCAC
GGCAAGAACCGCAAGTTCGGCAGCCGCAAAGAGGCCATGGCAGCCAAGGCAAGACCCAGTCGAACAGTCTGACAATGGTACATCTACTACTGTACTACTA
CTCACTTCGGTTTCCTACTGTCAACAACGCATGCAGATTGCAGCAGCGAAGGCCAAGCGGGAAGCCAAAGAAGCTGCGGAGAAGTAAGAGGACTCACTCT
CAGTATTTGATAACGGCGCGGACAATGTTGTTCGAGCCGCAATAGACTACCATATAGGAATATACAAGAGCGTCCGTTTTCCATTCCGTTTCAATGGCTT
TCTCGTGCTGCTTTGCATCTCATTTCAGCTTTAATCGAGCTTCTCGCGCTGAACTGCGCTCGGCGGAATGAAGATGGAGAGTGAGCGACGCTCGTGGCCC
GTGCTGCGAGCGCTGGTGGTGAAGAACTGGACGGTCAAGAGGCGCCATCCGTTCGCGACGTGGAGTGAAGTGCTCAACCCGCTGCTCTGCATCCTGCTGT
TCGTGGCTCTGAAGAAGTTCGAGACCGACTTGGATGTCCCGGCGGGATGGGCTACCAGCGATGTCAACGCGTCAGCTCCGGGGTACGGCTCGACGTGGAA
TCTGTACGCGGCGACGGACTTCAACTCGGCATTGAATGAAGGTTTGAGTAGTGTGGGCATTGTTGTACCAGAAGACTCTTCAGGGGGCAGTTGGGGCAAC
AGCTCTTCGAACGGGACACTGTCCGCGAGCGCACTATTGGGAGTCTTGAGCAATAGCCTGAAGATCCCCAGGTTCTACTTCTCGGAAACGACTATGGCGG
GATTGCTGCTGAGTTTATCCCTTCAGGCATTGATGGAAGGGCACAAACTCGATGAACTGGGCGAAGATGCACTTATGGATTGTGCTCTAAAGTTTCTGCT
ATTTGGTTATACTGGAGCTGAGCGGACCGCTTATCACGTTCCCAACGCTTGTCAGGGCAGAGTCGTGCCGTACAAGATTGCAATCACGCCTGACACGCCG
TATACACGAGAGTACTTCGCCGCGGCGCTGGAAACTTGGTATCCGCGTGTTGCACTTGCTCCGGTCGTTAAAGGGATATCACTCTTGACTATCCCGAGCT
TCAAAGACTCCCACGTGTTTTTCGATAATGAGACGGCGTTGGAGGAGTACGTTTCCAGTCGGGAATACGGTCTCGATCTGCAGCACCCGAAGATCTATGC
TGCCATTACCTTTGAAGAGTTTCCTGAGAATACTGCAGCATTTGGAGCGTTGGAGGCTCACTCAATTGCGTATTCCTTACGGTTTAATTCGACTGGGAGT
CTTGCGGCTGTGCCGAAGACCAAGAAGCCAAGACCCAACACCATTACGAAATTTGCACCAGCGGATGACAACATGGCTTATGCGACTCGAGGCTTCATGA
CCTTGCAGACTGTAGTGGCACGCTTTCTCAACTGCATGCCAACCTGGGACGCTCAGTCTGAAACAACGAATGGAACTTGCCAAGTCCCTCAGGCTGTTAT
GCCAGCGGATGCAGATAATGATCGTCGATTGCTGAAACAAGTGGAGAACGACATCATTATTGGTACTGCCTTTGCTTTGCTCAACTCGTTGAAGGACCTG
ATTACCAGTCTGGTCTCCGTGAGCCTGCCGAATGCGTCCGTGGATACAATTCCACCACTAGGCAGAGAAGCGCTGCTAGTGCCACTGCGTATGGCACCTC
AACCTTTCCACGGTGCGGCCGTATACGGAAGTCCGACACAAGCGTTTCGCTATGCTCCGTTCTTCGAGAAGGTCGCCTTGGTGTTCCCTATAGGCTTCGT
GCTGTCCTACTTGTACCTGGTATCGCGTGTCATCGTGTCTTTCCTAATGGAGAAAGAAACAAGATCCCGAGAGCTCATGCGAATCCTTGGTGCACGGGAT
AGCGAGCTCTTTGGCGGCTGGGTACTTGCTTACTTACCCATTTTACTATTGGGCGCGGTTCTGCAGACTTTCGGTGCTCATGGACTGTTGTTTCCCAACT
CGGATACGAAATTGCTGTTCGTGTTTTTCTTCACTTTCGCTACGAGTAGCTTCAGCTACGGCTTTATGATCAGCAGTTTGTTCTCAAGAGCCCGCGCAGG
GTCACTAGCAGGCATGGGGCTCTTCTTCATGATGTTTTTTATTTCCTACAGTTTCAATGACGACACCAGCGAGGTCGGTCGAACGTGCGCGGCACTCCTC
CCACCAATTTCGTTGTCCCAAGGCATCGGAGTGATCGCAAAGCTGGAGTCCTACGGAATTGGCGTGACGGGAGATAATGCTGACGACGAAGTAAGCAACT
TCCGGTTTGGAAATGCCGTTTGGATGCAGATTCTCGATACCGTGCTATACGTTCTACTCGGCAAGTATTTCGAGAAGGTTGTCCCGCAAGAATTTGGTGT
AGCGGAGAAGTGGTATTTCTTTCTGACAAAAGCGTATTGGTGTCCTCAAGCCTCTCAACTTGTCTCCGCAGAGGCACAAACGAACGAGGAGCTTGACGTG
GAGAACGATACGGTAGAGCCTATTCGACAAGACTTGAAGCAACAAGAGAATAGTGGTCGTGCCGTGGTCATTGCAGGCTTGCGGAAGGAATTCTCAGTGC
CCGGCGGGAAAAAAATTGCGGTTCATGGACTCGATTTGAAGCTTTATGAGGGTCAAATCACGTGCTTGTTAGGACACAATGGAGCAGGGAAAACCACCGT
AATGTCCATGCTTACAGGGATGACTCGACCAAGTAGCGGGAATGCTTGGGTCAGAGGCTATTCTGTCGTGAAAGATATGAGGAAAATCCGCCAGTCGCTT
GGTTATTGCCCTCAGCACAGTGTTCTCTATCCGGATTTGACGGTGAAAGAGCATCTAATATTTTACGGCCGTCTGAAAGGATTCACACATGCAAGTGAGC
TTACAGCTGAAGTTATCAAGAAAATCAACGAGGTCGGTTTGGTCGACAAGATCAATGTGCAATCCCACGCTCTTTCAGGTGGAATGCAACGTAAATTATC
ATTGGCAATTGCATTCCTGGGCAACAGCACGGTGGTCTTTCTGGATGAACCAACAGCGGGTATGGATCCGTATAGCCGACGCAGTACGTGGGAGCTCATC
CAGCGCAACCGCGCAAGCCGCGTAGTCATTTTAACGACTCATTTCATGGACGAAGCAGACATTTTGGGCGACCGGATCGCTATCATGGCGGAGGGGAGGC
TGCAATGCGTTGGGTCATCGCTGTTCTTGAAAAATCGCTTTGGTGTGGGCTATCGTCTCAGTTTCGTCCGACAGAGTGATGCTAAAGATTCTCGGTCTGC
AACTTTGCTGGTTCATCAGCACGCGCCTCAAGCAAATGTCGCGTCGGATGTCGGAACGGAGCTCACTTTTCAGCTACCGTTTGAGGCCTCACCTGGATTC
CCGGCATTATTTCGCGAGCTGGAGTCTCGTCAAGCCGAGCTGGGCATTCTCTCCTTCGCCATCTCTGTCACGACACTCGAGGAGATTTTTCTCAAGGTTG
CCGAACGCGGTAGTACTGAAATACCAGGATTCCACGACGAGAAGGTCACGACGAGTTTGGTATCTGATAAACCGCCTATTTCTGAGACCTGGGAAACAGC
GGTTGAAGTGCAGCCCCCAAACAGCAAAATTAAAGTCGCAGCGGAGCCAGACAGGTCTGAATCTGCCCCCACGCAGGCGTCATCCTTGCGTGCCATTAAC
ACTTTTACCAACCAGATGAATGCACTGCTTCGCAAGCGACTGCAGTACGGAAAACGCGACTTCAACATGTTGTTTTTCAGCACCGTCCTTCCCGTTGCCG
CCATCTTTGTCGGACTCTCGGCTCTAAAATTTAGCTCGGTTCTTGTGAACGACCCGAAACTAGAACTGTCTTCGACTGTGCAGTACCCGCTTGGACAGCA
AACCCCAGTCCCATTCAGCTGCCCTGGCAATTTCGATGTCGGTAGTGGTGCAGGCACCGGCTGGTGCTCCGAGTTGGTTGATCCATCTTACTTTCCGGAC
GGTACTGCGTACGAACTCGCAATTGATACAACAGTGTATGATGGAGTCGCGACACCTACAGTTTTTGGAGTTTCTTACGATTCACCCTCAATCGAGCCGA
ACGACACGAGTGGTTATAACCTTCGGTTTGCAGAGTTGGTCTTTGAAAGAGGATACGGCTATACGTCTGGTGCGGACTATTCAGCTCCACCTACTCAATC
TCCGGTGAAGGGGCAATTCGGAGGGTTTCTTTTGTATGCGTCAGAAACTACCAACACGTTGAGCTACAATGTTATGGCTAACGGATCATCAGCGCACGCT
GCGCCGACGTACAAACAGATGATTGATACTGCTATCAACCGCTTCCTGCTCACCAAAACTGGACAAGCGAATCCAAACGTGACAGTTCGCGTATCTTCGC
ACCCACTGCCGCTTTCCTTCAAGACACGGTCGATCTTCAGCTCGTATCTGAGCTTTCCAGCTGTGGTGTTCATTGTGATTGCCTTCACCTTCATCCCAGC
CTCGATGATGCCCTACATCGTCAAAGAGAAGCACCTGGAGCAGAACGCCAAATACCAACAACTTCTGTCCGGAATGTCGTTCTTCGCGTACTGGTTGGCA
AACTTTGTTTTCGATGTGGCCGTGTATCTCGTGCCCATGACAGCAGCCATTCTGCTTCTAGGATCCTACGGTGTTACTGCGTCTTTGGGGGGCGCCGAGT
CTTGCGATTCATGCACACAAGACGTTCCAGCTGCCACGGTCATGCTTTTTGTATTATTTGGCGCTGCTATCGCTCCAGCGACATACCTGCTATCTCATGT
GATGGAGAAGCCCACCGAGTGTCTGCTCTACACGGTCATGATCAACTTCTTCTTGGGTCTTCTCTTGTTGCTGTTGAGTTTCACCATGAATTCTTTAGAG
TCAACACGAGCAGCCAATGCAGTGCTCGTCTACATCTGGCGCTGCTCACCGTTATTCGCGTTTGGAAATGGCCTGCTCAACATTTTGCTGGCTGATCTAC
TAGCGACTTATGGGCTCACGAGTCAGACACGAAGTGCGTTTGACGCAGACATCGCTGGCACGGATATTTGGTACCTGCTCGTCGAGTGTCCAGTGTTTAT
ACTTCTAACGATTGGGATCGACGTAGTCCAAGCTGGAACAGTGCGTTGGCGGATTGCTCGGTTCCTGGATAAACTCAACTCAGCGCGGCGCGTGTACACG
CGCGTGCCTTGCAACAGCGCTAGACTGCACATTCAAAAGCCATTGGGCGGTAAAGTTGTCGATGCTGACCAAGCAGACGAAGATGTAGTCTCTGAAGCTC
AGCGGGTTCATGAAAGCTATCACTCGTTGAATGCCAGCTCGGAAGTGGTGCAAGTCTTCGAGCTTGAAAAAGTCTATCCGAACGGCAAACGTGCTGTGAA
AATGCTCTCGTTCGGGCTTCAGCAAGGCGAGTGCTTTGGATTTCTGGGTGTGAATGGAGCCGGGAAGACGACAACGATGAAGGTCCTCACGGGCGACTTA
CTGCCAACGTCCGGTACTGCCACGCTGAACGGCTTTGATATCCGCAAGGAGCGAAGACAAGCGCGCGAGTCGATCGGCTATTGTCCGCAGTTTGACGCAT
TAATCGACTTGCTAACTGTTCGCGAGCATTTGGAGCTCTTCGGCCGGTTTAAAGGCTACCATCGTGAAAGACTCGAGAAGGAGGTGGATCGCTTGATGAA
CAAACTCAAGATCCAAGCATTCGCCAACAAACTAGCAGGGAGCTTGAGCGGCGGGAACAAACGCAAGCTATCCCTTGCCATTGCAATGATAGGCGAGCCG
AGTGTGCTGGTACTGGACGAACCGTCCACTGGCGTTGATCCGTTCTCGCGGCGTCTGTTGTGGGACGTGATCTTGGAGGCGTCCGTGCAATCGCGACGGT
CGACGGTCATGCTAACAACCCATTCAATGGAGGAGTGCGAGGCTCTATGCAGCAAGGCCGGTATCATGGTGGACGGCCGTCTGCGCTGCTTTGGCAGCAT
CCCGCACTTGAAGACGCGCTTCGGCGACGGGTTCATGCTCGAATGCAAACTGGAGGGGCCCCCTTCGTACGCGATCTCAGATTTAACGCACCTTGTGTGT
GACCATCTTCAAAATGCTGGTGCGGAGGAAACTGGAGCTCAGATCACTGCTGCTCAACTTGCAGGGGCCTGCGCGGTTCTCGGCAATGCAAAGCGTGCTG
ACGTTGCTGCTCCAGCGTTGTTCACCCAGCTTGGTCAAGGCAACGCCTCCATTGATGTAGCTTCATTTGCTAGTTGGTGGTTGCTGGAGGACTGCGTGCA
GCACCTTGATGAGTTTCTTCGAGCACGATTCAGTGGTGTCACGCTGCTGGAGCGACAAGCCGACTTCTGCCGCTACAAGGTCTCCGGCATGAAAGCGGAG
GAGGAGGAGGACGATGCAGCGCCACAAGTAGCCACTGCATTGTCACGCATGTTTGAGCTGGTGGAAGACGCCAAGAACAGGCTGGGCATCAAGGAGTACA
GCCTGTCCCAGACAAGTCTGGAGCAGATCTTCAACTCGTTCGCTAGGCGGCGCGGTGCAGACTCGCGAAACTCCGGCAACGACGGCGCCGACTCGACGCA
GGTCTCCGAGTAAGGGTCGACCTCTCCAGTCGAGTCGCCAGTCGCACCCGAACGCATCTCGAGTGATCGTGATGCAAGGCGTGAGGTGATCCTCCCCAAC
CAGCATGTCATGCACGCCGCGCTGGGCGCGACCACTCATTTCCCCCGCGCCTCGACGGCATGACCAAGGCGCTCTCTGCTACTGTACCAGAGGCGCCGTG
GATTCTCGTCGAGTCGCGCGCGTTCAAACAGTAAAAGCTTTGCGCTGTCCGCGACGTGCACGCCCGATCGCCATTACCGCGGGAGATCGATCATAGCGAA
AGTTCCGACCTGCAAACAGCGCTAACGCATTTTAATCCACGCTCCACATTGCATCGACTGCATCCGAGCAGCTTTAAAGCACGCACGAGCACATGCACAA
GCCGCTCCAGCGTCGCCATCGCGTCCTTCGAGCAGGACATCCGACGCACTTCAACCCATCGCCCAGTTTCAAGAGGACGACGCCCCAGTAACTCAGGTGG
CGCTCATTGGCGGAAATCTTCCCGCAAACCGTCTGCAATAGTATGTACGAAACATAAGAATCAGGCTGACTCTCTACTGCCGTTCGATGCTGCCTCATTC
ACCGATTGTGCGTCTAGCAAGAGGTACCCCCCCTCTACAAGTCCAAGATGGTCCGTGTGCTCTCGCTCTCCGCCGCCGCCGCCGTGGCCGTGCTGGCATC
CTCGACCGCCGCGCTGGACCAGAAGCTCTACGGCATCAACTACGACCTGCGCCAGGGCCCCGACTGGGACCCGAGCAAGTGCAAGTCCGCGGACACCATC
GCGTCCGACCTCAAGGTCCTGAGCACCATCACGTCCAACGTGCGCACGTACAGTCTGTCGGACTGCGACGTCTCGGGCGTGCTCACGGCCGCCAAGAAGC
TGTCGCTCACCGTGTGGCTCGGCGTCTGGGTGTCCGAGGACTCCAAGGTCTACGACAACGAGGTGAAGGCCTTCAAGGAGCTCATCAGCGCCGGCCTCAT
CGACAGCAACGTCGTGGGAATCAACGTCGGCAGCGAGGCCGTCTACCGTGAGGACATCACGGCCGAGCAGGCCATCGAGTACGTGACCGACTTCAGGAAG
GTCATGGCGGACAACGACATCAGCGTCCCGGTCAGCATCACGGACATCGTCGACACGTTCGTGCAGTACCCGGACATGCTCAAGGCTGGCGACATCGTGA
CCATCAACCAGTTCCCCTTCTGGGAGAAGACCCCGGCCAACAAGGGCGCCGCCCAGTTCAACAAGCGCATCCAGCCGCTGCTCAAGCTGGCCGGCGACAT
GGAGGTTATTATCAGTGAGACGGGCTGGCCCACGGGCGGCACGGCCACCAACGGCTCCGTGGCTTCGGAGGAGAACGCTGCCATCTACCTGAACGACTTT
TACGAGCTGGCGGAGGCCAAGAAGTGGAAGTACTACTACTTCGCGGGCTTCGACACGCCCTACAAGGAGAAGCAGGCGGACGACGCCACCACGGTCGAGT
CGCACTTCGGCATCTTCGACGAGACGGGAACCATGAAGTCGGCCTACGCCGACCTCAAGTTCACCAAGACGGGCGACTACTCGACCTCCTCGGGCAGCTC
CACCACCACCAGCTCCGGTTCGTCCAGCGAGGCTGTGGGCACCGTCTCCCCCGGCGGCAGCGGCACGTCCACCACGACCAGCTCTGGTACCACTGGTACC
ACTGGAACCACGGGCACCTCGGACGCCACCACGTCGTCGTCGAACACCGACACGACGTCTAGCGCCACGACCGCTGACAGCGGATCGTCGCAGCTCATGG
CCGCCAGCCTCGCCGCCTGCCTGGGTGTCGTCTCCACCATGCTCTGGAGCCTGTAAGCATGTTCGTATAGCTTCCGCGGTAACTAATGCACAAAGTGAGC
TGTTATAGTTTTTCCATGGTCTTATTGGGAGGGGTGACAAAACAACTTCCGGAGCAAACCTGCGCAAGTTATGGCTTGAGATTTCATGACATCCGTCCTC
TCTTGCTTTCCCGTTAAAGTACGACAGCAATTTAGGTCAATCCACATTCGCGATCGACCATGGCCAGCACCAACGCGCAGGCCGACGGGGCTGCCAGCAG
CGACACCGCAAACGAAGGGCTGCTGGTGCTGGTGATCGACACCAATCCGGTGCACTGGTTCGCGCAGGGCGGCAGCGCGGCGGACCGCGCGGGGCTGCAG
CAGCTCATCTCCAGCACGCTCGTGTTCGTGAACTCGTACCTGCTGCTGCACCGCAGCAACCGCATCGTGATCATCGCAGCCCATGCTGGCAAGAGCGCGA
TGCTGTACCCAGACCCAGAGCAGGACGACACGACTGGGAGCGCCGAACAGGCTGCCAGGGTGAACGCTGGCGTCATGCAGCGGCTGCAGCAGCTGAGCGA
CGCTCCGCTCGACCCGGCCAAGCCCAACCGAACGGCCATTGCCGCGTCACTGTCGCGTGCTCTTTGCTGTAAGTTGTAGCGCTCCTTATCGTTTTTGCTG
TTGAATGTGTATTGACATCATTGTGTGACTTGGATGCACAGTCATCAACCGCGCCATCAACGAGGAGCCGGATCTGCGACCGCGGATCTTGGTCGTCCAG
AAGTCTCCGGACGTGTCGGAGCACTACATCGCCATCATGAACGGCATCTTCTCGGCCCAGAAGAAGAGCGTTGCGGTCGACGCCTGCATCCTTGCAAACG
AGCACTCGTCGTTCATGCAGCAAGCAGCGTATCTTACGGGCGGCATCTACTACAAGCCCAACGACCACAGCGGCCTGCTGCAGTATCTCATCTCGATCTA
CCTGCCAGACCCGTCCATGCGCAAGCTGCTGAAGCTTCCGTCACAGGACTCGGTGGACTTCCGCGCAATGTGCTTCTGCCACCGAGAGGTCATCTCCACG
GCGTACGTGTGCCCCGTGTGCCTGTCGCTGTTTTGCGAGTTCCGACCCATCTGCTCCACGTGCGGCATCCGCAGCCACATCCAGCCCAAGAAGAACGGCT
TGCTGAAGAAGCGCCCGCGCGTTGCCTAAAATAAAATGCAGTCGCTCAGACACAATTATCAACTCAATGCAATTTGTTGCCTTGAAGCGATGTTGTAGTT
GCCGTTGACGTTGCCCAAGCAGCACAGCATCTTTACTCTCGAATTGGATTGGGTGAAAGTCGTCTCGTTGGCAAAATCAAGATTATGCGCACATTCTCGC
GCGGTGTTTGGCTGAAATTGAGATCAACCAATAGGCGCCGCTCAACGGGTAAAACCAACTTGAGCTCTCGGCACCGACATACGCAGACTCTCCACGCAGC
CAGCACACCACACCGCAGCACCATGAGCAGGTCCGAGCTCTTCTTCTACCGCTTTATCATTACGATGAAGCATTAACCCGTTTGGCATTGCACGCCATTA
TTTTGCTGCAGACCCACGATCGCAGAGGTTATCGCCGAGCGCAAGGCCAACAACACGGCGGCCTTCATCACCTTCGTGCCCTGCGGCTTCAAGACCAAGG
CCGACACGGTGGAAATCCTGCTGGGCCTGCAGCGCGGCGGCGCCAACATCATCGAAGTGGGCATCCCGTACTCCGACCCTCAGGCTGATGGACCGACCAT
CCAGCGCGCCCACCAGGTGGGTGTGGACCAGGGCATCACGTTGACTGACGTGCTCGCCACCGTGAGCGAGGCGCGCGCCAAGGGCCTGACCACGCCCGTA
GTGCTCATGGGCTACTACAACAACATTCTGCAGTACGGAGAGGACAAGATCTGCCCCGACGCTCAGAAAGGTGAGTGCGCTGTGCGCTGCTGCTGCTGGT
GGATGAAATGGAGACGCGGACTAACTAGGTTATTGCTGTCTGCAGCCGGAGTGGATGGATTCATCATCGTGGACTTGCCGCCTGAGGAGGCCAAGCCGCT
CAGCGACGACGCCGCCAAGCACGGCCTCGCTTACATTCCGCTGGTGTCGCCTACCACAACGGAGGACCGCATGAAGCTCATTGACTCGGTGGCGCACGGC
TTCGTCTACTGCGTGAGTCTCACGGGCGTCACGGGAGCTCGCACCGACCTGCCGCCCAACCTTGACGCGTTCATGGCTACGAGTAAGTTGCTAGCTTCTG
TTCTTGAAGCTTGTCCTTCGCAGCGCTGCTGACGTTTTATGCTTCTGTTGTCACCTATTTGTTGCAGTCCGCGCGAATGTGAAGCACCCGCTTGCGCTGG
GTTTCGGTCTGTCTACCCGCCAGCACTTCGTGCTGGCGAGCGCGCTCGCGGACGGCGTCGTGATCGGCTCCAAGATTGTCAAGATCATTGAGGACGCGCC
CGACACGGCGAGCCGCGCCGCCAACGTGGAGGCGTTCTGCAAGAGCATCGTGAACCCGTAGGCTGGCCTCGTACCTAGAACTGTCGTCTTTCAACTCTCC
GTCGTGAGCGCACAACCCCCACACAATATACTACTAAATAGCGCTTTGTATTTGGCTTCGCTGGTGTGTCTTCCTTCTCCGGTCTTGATGATGCTGCTGC
AGCTTGATCCTCTATGCCCTGAAATCTGTGAGTAAACTCGTTGCCTGTGGCTCGACCGGGTCAAGCGGGTCGCCTCTCAGGTCTCTCGCCAGCGTGGGTT
CGAGTCCCGCCGACAGCAAAATCGGGGCCAAGCAATCCGTTCGTATTTAGGATAGTAGTATACAAATCGTAGCATACTTCGAAGCCCGGTGTGTCTGTGC
CATTAGACTAAGGATCGGGTCAAAATGTGTGCGATAGTGACCAAGCGTGTCAGGGTGTCAGTACTGGGTGATTCGCCAAAATGGCGCATTAGTCTCAGAA
TCTGCCAATCGACATGCGCACATTCTCCCTTTTTCAGCGAATGAAAGCAAGCGACGCGAAACGGCGCGGCTCGCTTCAACTTGACCCTTGGCGGTTACTT
TGGATACGTGCGGGAAGACGGCGATGGACGCGCTGGAGGCCAAGAAGAGCGAGGGCAATGCGCTGTTCCAGCAGCAACGCTTTGCCGAAGCGGTTCAAGT
CTACACCTCGGTGCTTGATGGCTTGGCAAGCTTAGGGGCTGCCGAGGAGGCAGCTGTGCGACTCAACACGGCGGTGAGACTCAACCGCGCATGGGCGTGG
ATCCAGATGCCCGAAGGCGACGGCAGCGCCTTCACGCTAGCGGCAGCTGAGCAGGACTGCAGCGCTGTGATCGGTAGGGATCCATGCTGTGTGAAGGCGT
TTTATCGCCGAGCGCTGGTGCGAGAGCGCATGAGCCACTGGAAGGTAAGATAATGATGCACGTGCTGCTACTCATGACCGGTAGTACCCTGACGGCTAAC
GATACTCTAGTCTGCAATGGAGGACGCGACCGCTATGAAGCGCTTAGAGCCCAGTAACCCTTCAGTAGGCCCGTTGCTGGAGAGGCTGCGACGACGTATA
CAAGAAGAGAAGGAGGCAAAGAGCTTGGCTCCGAATTTCCAGCAGTGCACGATCGATGAAGGTGACAACAGCACGAGCTCTGCCAGTATAGACCTGGGTG
ATGAGGCAGACAGCGCTTGGCGTGCCCTTCAAGCAGACGAAATGAACCTCCAAAAGGTTTATCATGCCACTACGAAGCCAAGGCGCAAGCCAAGGAAAAC
ACGGAAGGACACAAAAGCAGCACAAAACGAGCAACCAGCGAAAGGCAAAATATCGGAGAAGACGGATGATCTCTGGGCATCGCTACGGCGAGAGGAGGCC
ACGACGGTCGCAAAAGCGTTTCCTCGGTCGAGGAAGAGCCCCCCAGCAAGTTGAGCATTAGCGAGATGTTAACGGTAAATCGCAGTCACTACGACTTCTT
CCATTCGATAGGGCACCTGCAAAAAGTTAGCCTCAAGAAAGAAGACAAAACGAACGCAATCTATTACCTTATTCCTACCAGTCCTCATCTTCATCGTCGC
CCAAGTCGATGATTTGTGGGCGCGTTTTACGATAACGAAGCCCACAGCTGGAGCAGCTTGCATTGGATCTTGGATTGATCAATGTGCAACGTGAACAGCT
CCACACCGAAGGTACCTCGCTTTCTTTGTGTTCATCGTCCGAATCCACGACTTTTTCTTTACGAGATGAGCGTTGATCGCTAAGGACATCATCCACGAAG
GCGTCCTCTTCATCCGAGTCTGAAAAGTCTGAACTGAATCTCCGCTTCTTCAGTGGGAAGCTTTCGACTTGCGAGGCAAACGAAACTCTCCTCTTCAACT
TAGAAGGGTCTGCGGCAGACTCTTGAGGTGCTTCCTCCTGAGCAGGATGCGACGACACTTCCAACGAATTCTTTGCTGGTGGGGGGCGTCGAAGTGGCGG
TTTTGGAGTGCACGATATGTCGACTTCATCGGATAAAGATCTTTGTCGGGGAGCGGAAAGTCGTGCACCTTCACCCCCACTCTCCGACTCACTTTCGCCA
AGAACTTCGTCGTGCTCTTCTTCGCTGCTGCTTGAATATACGACCTCTGACTCATCAGACCCATCCGTGGCTTTCGACGCCTTCGACTTTGAACGCTTCG
AGTTGTTCTCCTTTTCAGCGCGCTGCTTGTTTGCGGCAATGATCTCCAAACGCTTGCGCTTGCGCTCTTCATCACGCTGATTCTCTTTTTCTTCGTTTTC
AGCCTGGTGCTCCTGGAGTAGTTCCCAATCGATACGACAGCTAAACGCGAAACTCACTAGATCATTCTGAACTTGCTGAAGTGCGGCTTGCATGACTTCA
TCGTCGACAGAGGCGTAGGCACGGTGGTGACCCCAGCTGTTCAAATCCTCTTCTGGGGGCATGCCAATCTGCGGGTGATAACACTTGTCAGCGTCCTTGT
CATTATCTTCGTCACTTGTGCTACGATCAGGCGAAGTTTCATTTCCAGATTCCTTCCCATTTTCGTCATCGTCATCAATTGTAATTACTGAGGCGGCATC
ACCACCAGCATCGCCGTCGCCTCTCCATTGGCAGCGATCACATTTCAGCTGGTCGTGTGTGTCAGACAACGTATCCTTGCGGAATACAAACAGCCGCTTC
AAGTCCTTTGACGACAGCGAATTCACTTCCTCTTTATCGTCGACGATGTTTTGTAGGCCCTCCTTTGAAAGCTGCCGTTGAAATATCTTCTCTTCGAGTG
TACCAGTCGCCAGAAAACGATACACGTAGCACATCTTCTTCTGCCCTTCTCGCCACACACGAGCTGCAGCTTGCTTGTCCGTCGCAGGATTCCAATCCGG
ATCAAACAGTACCAATCGGTTCGCACCAATTAGGTTTAAGCCACACCCGCCAGCTTTACTCGACAGTAAAAACGCAAATGAATTCGTGGTGGGATCATTG
AAGGTATCAACAAGCTTCTTCCGTTTCTTTGCCGAGGTGGTTCCATCCAGACGAACGAAAGGCAAATGGCGTTCCTGGCATAGCGTTGATACCACATCCA
GCGTCTGTGTGTAGTTCGAAACAATCACGATCCGGTCTGTTGTTGTCTTCCTCATCGCAAACATTAAGCGGTCGAGCAGAAGCATCTTACCCGACCATTC
TGGATAGCAAGTGCGACCACCGAAGCCTCCTCGTCGATGCAGACCGTTATCACCCCCAGTATCTCGGGATTCCTTTGCTGCTGAGAAATATTGTGCACAA
TTGCTGAATCCTGGAAGCTTGGTATTGGTTTTACCCATTTCGTCGAAAATCAGCAGCGGATGATTGCAAAGTTTCTTTAGCGCTGTGATAGACGACAGAA
CATTTGCGCTCTGACGTTTCATCATATCACGGCACGCACTCGATGAAAGGAAGTGCATGTAGAGTTGCTCCTGCAGAGGAGACAGCGGACAGCAAATCAC
TTGCATCAGCTTTGGCGGGAGGTGCTTGGCGTTCAGTATGTTACCACGGCGAAGAATGAACTGGTTCACAATTTCACAGAGCATAGCCGAGCACGACTGT
GCCACACCTCGTTCACGATCTGTAGAATCCGGTTCTCGGCCAACCAAGATTGGCCCCAGGTAATTCTTTCGAAACTCACTTGGTGTGCCCAAAATATTGG
GATTGGTAAAGTCCACCATTGCGAAAAACTCTTCCAAATCGTTCTGCATCGGTGTACCAGAGAGCAGCACTCGTTTTCGGCACGCCAGCGACGATAACGC
CTTGTTAATCTGGGAGTTGGCATTCTTGAGTCGATGCGCTTCGTCACAAATCAGCAGCTCACAACATTCTGGAGTATCCGCGAATTTCTGCGCATGCATT
CTGAACGTCTCGTACGAGATGATCAGTACCTGTGCCGAGAATCCTGGTCTCGGTCTCTTGCTTCCTTCGATAAACTGGTTAATGCCTTTGATCACAGTCT
CACGCTTCGCCTCATACAACGCCACAGTCTTGACACGTCCGTGCAACCACTTGATAATCTCATCGTCCCAATTCTTCACCAGTGACGTCGGGCACACCAC
AATAGCTCGCTTCACAGTTGGCTGCATGTCCATGCCCGTCATCAACAACGTGTACATGAGCGTGATACTCTGCAAGGTCTTGCCCAGACCCATGTCATCA
GCAAGGATGCATCCTTGACCGTCGAAGCCCCTGACTTGGCACACACAGTCGAACATGAACTGCACGCCCTCACGTTGGTGAGGACGCAGGAACTTGCCGA
CGATTTCTGGCACCACCACCTTGATCTCTGGGTCAGTTTCGCTCTGCCACAGCACGAGAGGCGGCGGCGCTTCGGCCGCTGGCGCAGCAGCAACAGGAGC
CTCTTCTACTGCTGGAGGCTCCGGTTCCACGAGCGTCTCGACCTCCTCGACGTCCACTTCAACAGGCGGCAGGTCGTGGCGCACCATGGGCTTCAGCGCT
GAGCCCCAGCGCCGCCGCATGCCCAGCGTCTTGGTCTGCAGCAGGCGGTTGCTCTCCTGGGTGCGGCCTCCCTCTCCACACGGAGACTTGAACTGGCGCC
GCACGTGCTGAGCGCGACGCTCGGGCTCCATCACCAGGAAGGACAGGAAGGGCAGGCGCTTGACGGACAGCGACCCGCCGCTGCGCAGCGCCTGGCGGTT
GCTGGCGGCGTCCGCGTCTTCGTACGCGTCGTTGTCTTCATCCTGCGGCTGAGTGCGCGTGGGCTTTGCCTTGACGGGCAGCACGAACGGCTTGAACTTG
GCGCCGCCGCCGCCTCCAGCAGGCCGTCGCCGCAGCATCTCTCTGCTGGAAGAGCTCGATTCAAATTGTACGGAAAGGCGGTAAATGCTAGTCAAGCTAT
GAGATTGGTAGAAATCAATGGAAAAGACCATCATTCAGGGTGGATAAATGCCACTTCGTATGTGATTGGAAGAAAGTGAGGAAGTGATGTTAAACGGACT
TTGCACCAATAGCGGCGCAGACAACCTCATCCGCTCTCAACGGTGCAAAATGGTCGCTGGGGCGCAGGTGGCGGCGTTCCAGCGCGCGCTTCTCCGTCGG
ATACAGACCGCTCCGCTCGGCCGAGCAGCTTCGGCTGCTACACAAGACACCGTGCTACCTATTGCAGGTCTCCGTGCGCGCCAATTCGCTGTATTGGCTT
CGAACGACCGGTCAGCAGGTCCTCAGACGGCGTTGGAGCGACTATCGGAGGCGTCCAAGCCGTCGTGGCGACTACGCGCGGCTGTGAAGGATGTGGAGGC
GTCCTTACCGTCAGACAGGGGCAGGAGGTTCTACAACCGTCGAGTGCTGGAGGCACTGGAAACCAGCGACCTCAACCGCGCTTGGGCCATCGTGGAGACG
CTGCTCCGCCGGCACCCGGACAAGGCGGTGCTGTGGCCGTACACGTACAACCTGATGCTGCGGCACTACTGCAAGCAACAAAAGACGCTGATGAACGCCA
ACTTGACTCGGATTCTGGCCCTGCTTGACGCTATGGTTGCCCAGGGCTGTGCGGACCAAACGAGCTTTCAGGTGGCGATGGCTGCGTGCAGTCGCGCACG
CCATCTACGCAGTGCGAGACATGTAATGGAGAAGATGCGAAAGTGTGGAAGGAAGCCTGATGCAAGGATCTACGGGTTCTTAATCAATTGTTGTGCGAGG
AAGCAAGGATTAGTGAAGCTCGCGAACCAGTATTTTGAGGAGATGATGCGTGATGGAGTGGCACCGACGATTCTGGCGGTCAATGCAATGCTGCGTGTGT
ACTCTCGTGATTGTGGACGGTCGACGGTGATGCTGGATCTGGTTAAGCGTGCGCAGGATGAATTCGGTCTTGTCCCGAATACTGTAACGACAAGGACAAT
GGTGTACTACCTACTGTGTGAAGGTGACGTGGACGGAGCTGTGCAATTTCTACGTGATGTTGAGAGAGCATTTCCCCTTGAAGACTCCATAGAATTGCCT
GTGCGGCGGCAAGTTGTGAATGCGGTGGTTGATAGTTGCCGCCAGCGTGGCGAATGGAACTTGGTGGAGTACGCCTTGGCCTTCGCGAAAAGGAGCCAAC
AAAGTGCTACTGGGGACAGCGATATGCAAGACACTGCATCGCTGGAGCAGCTGGTTGCAAAGCGTGACGCGATATCGAATGCAGTCGTGTGGACACTGGA
CGAACAGGATTGGTCTCGGATGGCGCGATCAGACCAGGAAGCATTCCTTCTGAACCGAAGCCAGAAAGAGAGTGTAGAGCGCTCGTTGGAGCGCATGCAG
TTGCCCACCAGCTCGGATCGAGCGATTGAAAGGCTTTCTCTAAAATTGGATGGCAAACTACGTGTACTGGACGAGATCATTCACGCCAAGAACGCAAGTG
CAGCAGATTTCAATGCCGTTTTAGGTGCTTGTGGGAGACAGGGGAACCTGAGTGAAGCGGTGTCTGTGCTTACAAAAATGAAGAAGTACGCCGTGTCTTC
TCCGGAGTGCACACCGACGACGTGGAGCTACAATGCGCTTTTGAATGCCTGTGCGGTCCGTGGTGATGCTCGTCAAATAGATTCAATTTTGAACGAGATG
ATCGAAAGTGATTTACTACCCGATCAAGTGACTATGAACACGGTACTCAAGGCACACACCGCAAATTTAAAGAGTAGTGGGAGGGATGCACGCGCTCGGG
TCAAAATTGTTATGGAAGGTCTCTCGTTCTTTGAATGGTGCACTGAAGACCAGAAAGTCGATTCAGGGGCCGCGACATACTATTCGCTCTTCCGGTTATT
TTCTACGTTCTTGGAGAGTCCAGAAAACAGCAATACCGATGTCGATGACGGCCTGCTAGGCGGCGAGGACCGGGATGAAGAAGTGATCGACGGACAAGAG
TTGGAAATGTTGGCGTGGATGGCGGAGTTTATCACCAATACCTGCCGTGACGCACCGCTCAGCTCACTTGATGTCGGCGTGTTTAACAATGCGTTCGCTT
ATTATCACCACCTCGGGGAGGTGGATGCAGCTTTCGCTTTATTTGACTTGATGAAGAAACGTGGGATTCAACCGGATGATACGACATTGGGGCTGATGTT
CGCGACCTGCGCAAGCCAACAGCAATTTGAGGTGGGCTTAAACTTTTTGGATCACATCATGGCTGCCGATGGTTATAAGCCTACTCTGAAGGTACTCAGT
GGAGCCATGCAATTGTGTGCAAATTCAAAGAACCCTGATGGCGCGCTGGAGCTCTTCCGTGCAATTGAGACATCAGGCGCATTTACTCCGACGATCGAAA
CGTACGAGCCATTGGTGTTCGCATATGCTCGCGTTGGAAATGTATCTAGTGCCTGGGATATCGCAAATGAGATGGAAGAAAAGCTTGGTAGGGCCTCTGT
AAGTATCTATAACCGCATCCTGTTGGCATGTTCCGAGGCGGCACTTCCTGGACGTGCGCTTGAAGTACTGGATGTGATCCGCCGTAAGCGTGCCGTGACC
GCCGACATCATTTCTTACAACACAGCATTAGAAGCTTTCGTTAGAGCTGGGGAGCGGGCTGCGTGGTGGAGGAAGAACAGAAACAACTGGGAGGAAGACG
ATGATGTCGTAGATTATGACGAGGATGGTGATGAACAACTGAGCGACGAGCTTCACAGTAGCGATGAAGCTTTCGCCCAGACTAGTGAAGATTTCGCAGT
GGAGTCACCGCACTACTACGATTATGAACAGCGTGAAAACGCTGCTTGGGCTCGTGCAAGCATTATTGAGCTTCTGGAGGAAATGAAGCAGAACCGATTG
AAGCCTGACATGACGACGTATGAGCATGCGATAGCTGCGTGTAGTGTGAATGAGGACTTCGAGGGTGTCATTACCATTTTTGACACCCTTATCAACCGCA
AGCGGGACAAGAAATCTGTTGAGCTGAAAAGTGATCTCGTGAGCGACTCAAGCTTTTCAGCGTATCTTGTGGCATGCACATCTTTGGAGGACAAGGATCG
CGTGGTCGAGGTCCCGACACTGCTTCACAAGTGGCACACCGCGACGGGCCAACTTCCGCCAGTTTTTGTCGTCACTCAGTTATTGGACTCGTTGGAGAAA
GTCGGCGAATGGCGTCGCGCTGTTCGGATGCTTCCCGATATGCAGGCAATGTTTGGTATTCCGCCCAGCATTGCCGTGTTTAATCGAGTCATGCAGATGT
GCAACCATGCAGGAGAACATCAGCTTGTCGCTCCAATATTCGCCACTATGCAGGATGCCAGCGCCTATCGCGTCTTTCCTGATGCTGAGAGCTACATCCA
ACGAATCTACGCAGAGGAACAGCGTGAGAACTGGGTAGCGGCCACCGATCTGTTTGTCGAAATGCAAAATAATTGCCCAAGTGAAGAGATTTCTCATCAC
CAGCTTCAGAAGATAGCGTTAGGTAGGTACAGGATGCGCCAAAATGATCATTAAATGCCAAAGTCTCCTGTTTCACACCTGTATGCATCCGCCCAGCATC
ATTGCTACAAGTGAACATGTACATACTCACATTTGGTTTTCAAGCAGGCTCTCCTCTTCATCGCGCAGCTCAGGAATCGAAGACGACAGAGACAAACCGT
AGTTGGGGCTTCCAGGAAAGCTGCTCGACGTAGTGCTGGCACTGCTGTAACCTTCTCCATTGCTGTTGCTGCTGGGTCGAGCGTAGATGGACTTGTCCGA
GGCGGAGCAGTGGAAGAAAGCCGCACCAAAGACGAGGACCAGTGCAGCGATGGCAAACACGAGGTC