Description :
From Genome Similarity Track
Location :
Scaffold_652:6699- 11476
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-fgenesh-gene-0.3EF hand family protein

Sequence
4777 bases(100 bases per row)
ATCATTGCGCGATGAAGCAGTCGCGCAGCAAGATCTGCAGCAGCTCGTCGCTACCGAGTGTCGCGCACAGGTTCACGCAGTAGGCCTCAAAGTGCTCAAA
GCCTACAGTCGCAGTACCGCTGACACCGTCGCGATCTCTCTCGCCAGAGATCTCAAAGCTCGCGGCAAACTCCTGGAACACAACAGCGGGCGACGCGCCG
CCCAGTTTCACGTCCGGGTGCTGCTGCGCCTGGAAGCTCCTGGCAAGCGCCACGGGGAACACGCGGCCCTTGCCGGCGTTCGCTAATGAAGTAAACACGC
GCTGAGCTGCGTCTGCGCAGGGAGGACTCAGCGACCCCAGGATGCAGTGGAAGAGCTTGCGGAGCGCGATGCGACTCAGTGACGTCTGGCTGCTCTGTAC
GAACCGAGCGCCAATAGTGTTGCCGCTGCTGGTATTGCCAGTCGCGTTGCTGTTACTGTGCTGGTCGACCTCGCGCGCCTCCGAGAGCTGGTTCATGAAC
GCAAAGAGCGCGACGCAGTTCTCCTCGGTGAGCGTGAGCCCCAGCGTGGCGCTCAGACACTCGCTGCAGTGCAGCGCCGAGATCGTCGCGGTCTTGGCGT
CGATATACTGCAGTGCGCGCTTACGCAGTGCGACGATATCGATGACACGCTTCTGGCGGATGCGGTGGCGGATTGTGTGAAAGACGACGTCACCCTGGGT
TGTGGAGTGCTGGTTATGTTCACCTGAGGTGAACGCCTGTTGCGACATCTCCATGGGGACGGCGCTGGACGCCTCTCGCAGCGTCACGATGCGCTTGGCG
CCATTGCTGCTGCCATTCGCTGATAGAGACAAAGCCGAGGAGCCTAATGACTTTGCTGGTGGGTCCGTGAGGTTGAGGCTCGACCCAGTCATGCTCACGA
CGCGGGAGACACTACTGCTACTGGTAGTGTCCTGTTGCTGTCTGTCCTGCGTCTGCAGCCGCATGTGGACATCCTGCACTTTGACGCCCAGATCGTTCTG
GACCTCGCGCACGACGTCCGTGCCGTCGGCGAGCGTCACGAGCACTCGTCGGTTCGTGGAGTTGGCGCACCAGCCTGCACCGCCGCTGATATGCCACGCG
TTGCGCATCATGAGCTCAAAGTAGTCGTCGTCGTCGATACTGGCGCTGATGTTCTGGTAATAGTGGAGCCACTGGTCCCACGTGATCTTGCCGTTGTGCA
CGCCGTCGACGTCAAAGGTCTCGAGGAACTCGCGGCAGACTTGCTCGGCGCTCTTCCGACCCGAGAGCACGTCCGGGTGCCGGCTGGCGTCGTACGCCTC
GATGATGTCGCTCGGCTCTAGCAATCCGTTGCCGTCCTTGTCCATGAGCCGGAATGCCTCGCGCACAAAGAACACGTGGCGCTCGTTCAATGGATCGCGC
ACGCCGGCGAGGAACTCGTTGAGGTCGATGCTACCGCTGCGGTCCCGGTCAAAGTACTGGAAGAGCAGCCGCGCGTCGGCGTCGCTGAGCTCGAGATCCA
TTTCGCCCATGGCTTTGCGGAACTCGCTCACATTCAGCAAGCCGTTGCCATCATCGTCCATGATGCGGAACTTGCGGCTGAGGCCGCAGAACCCGTGCGC
GCCTTTCGCCTTGAGTCCGGTCTTGAGCTTAGAGATGATGAGCTGGACGCCCACCGGATGCTCGTGTCTGTTACTGAGATTGTTGTTGTCCTGGGATGTA
GCAGCACTCGAACCAAAACCAGTGGCGGTTGNNNNNNNNNNCTCCATTCCCAGAACCCCCAACACCGGATGAGGAGGTCTTGGTATTGAATGTGTTCATC
GTCAGACACGCGGAGATCAAGTCGCTCGTGTTCCCTCGTGTTCGTTGCGCTGTGAGACCCGCTGCCGCCGAACTTGAGGTTGATTTTGAGGCGGACGTGT
GGTCGAGAACGTCGTAGAAACTGGTTTTCACTTGCTGTCCCACTTGCCCCAGTTGTTTGGCGAGTACCCGCGTGACGTCCTCTCTCTTGACGCCAATATC
GTTACGCACCTCCTCGACGCTCGCGGACCCGTCGGCATGGGTCACGAGCACNNNNNNNNNNGCTGGCGCTGATGTTGGCGTAGTAGCGCGTCCACTCGTC
GAACGTGACCTTGCCGTCGTGAAGCTGGTCGATGTCAAACGTCTCGATGAACTCCTGGAACACGTCGTGCTCGGTCTTACGGCCCGAGATCACCTCGGGG
TGCTTGCGCGCGTCGTACACGTCGACGATGTCGCTCATCTCGAGCACACCGTTGCTGTCCTTGTCGATGATGTCGAACGCCATGCGCACAAAGAGCATGC
GTCGGTCGTTCATCGGCTCGCGGATGCCCGAGAGGAACTCGGTGAAGTCTACGGCGCCGTCGTGGTTCGCGTCAAAATACTGGAAGAGGCTCTTGACGTC
GGCGGGTGCCAAGTGGAGCTTGGTCTCCTTGAGCGCGCACTGAAACTCGTGTAGACTGATGCTCCTGTTCTGGTCGTCGTCCATGAGGCGGAACTTGCGC
TGCAGCGAGATGAACCCCACGACACCTTGGTCCTTGAGCGCTGCACGGAGTTGGGAGATGATGCGACGGAGCTCTTTGGTCTGCTTGGCGGCTGCGAACA
TGGATTCTGGAACTCCAGACGCCGAAGAAGAAGATGGGCCTGGGTTGCTCCCTGGATGGCTCATGCTTGCGTGTGGATCGTGGTGGTGGTCGCTCAGGTC
TGGCTGGAGGATCGCAAACGCCTGGCTGCTGCCGTGTCCAGATCCTCGCACGACCCTGAACTTCCCACTGCTGGTCCCAATAGTAGCACCCCGAGGCGAT
GACGGCGCTCCTGGTCCACTGGCATTCGACTGACAGCAGAGATCGCCCTCAAGCTGGAGGTTTGTCAGCTGCCACGTGTTGCGGATCATGAGGTCGAAGA
AATCGTCGTCCGCGACGAAGAAGCTCACGTTCTGGTAATACTGCTCCCACTGCTGGAACGAGATCTTGTCACCGCTTGTGTCGTGCGCACTCTCGACATC
AAAACTCTCAAGGAACTCGTGGAAGATGTCCTCCTCGATCTTGCGGCCGGAGATCACCTCCGGGTGCTTGCTCGCGTCGTACGCCTGCACGATCTCACTC
GGGTCCAACAGCCCCGACTGGCCTCGGTCAATGCTCTGGAATGCGGCTTGGACGAGCTGGAACCGGCGGTAGTTCATCGGCTCGCGGATCAGGTCGAGCA
CTGCGTGGACCGCCGCCAGNNNNNNNNNNNNNNNNNNNGCTGAAGAGACAGCGCAGGTCCACGTCGCTGAGTTGGACGCTCTCGAGCTTGAGCACCGCGC
GTTTGAACTCGGAGAGCGTGAGGAACCCGTCGTTGTTTTCATCGCTGAGACGAATGTCGCGACTGAGCTCCACGAGTCCACGCAATCCGCGCTCTTTGAT
CATCGTCCGCATCCGGTTGAGGACAGATGTCGTGCCAGCGTCCACCGCGGGTCTCCCCGAGGAAAATGCAGACAATGGGGACGCTCCAGCTGTGCGTCTC
GACGAGATACTGTAACTGCTTGAAGACGGCTGGCGCATCGACGGGTCGACCATGCACGCTGCAAACTGCGCACCTTTGAGAAACTCGTTCGTGGTGTGCG
TCGCCCGTGGTGAGACGCCGTCGGCCATGGCTCCACCGCTACTGGTGCTGCTTCCAGTGGTATTTGTACTCGCACGATGCAGACGTGAAGGAATTGGTGG
CGGGAGTAGTACTCCAGTGGAGATCGACAGCGGCGTCTTGCTGTAGGTGGATGCCATCGCCGGGTTGCTCTCTTGCAGCGCCTGCATTAGCGTCATCGAG
ACGATACCTTCTGCTTGCGGTGAGGCACTATACAGCCCTGAAGAGCCGAAGCCCGAGCCAAAATTTGCGGCGGAAGTACCAGCTGTGGCTTCGCTGAGCG
ACGTGCGACTCGTGGCTTTCCACACGCGCTTCATGAGCAGCTCAAAATACTCGTCACTGGGCACGTGGCCGCAGATATACTGGAAGTAGCTCATCCACTG
GTACAGGTTCACAAAGTCCGCGCCGATGTTGCGCGTCGCACTCTGAAACGAGCTCTGGAACTCGTCCTGGACCTGCTCGACGCTCTTCTCGCCAAACATG
ACGCTCGGGTGCTTGGCGGCATCGTGCGCTGCAATGATGTCTGCGAACGAAATGTACCCGACGCGCTTGCGATCGAGTGTCTCAAAGACGCTCTGCACCA
GGTCGAGGCGTCGCCCGGTCAGCACGCCGCAGATGAGGTTCTTGATCGCGTCCGGTGAGACTTTGCCGTGGTCGTCGTTTGCGATGTGTTGGACGATCGC
GCGCGCGTCCTAAGGTGGCGAACGATACATAGGCGATGATAAGCCTAGGTTGGAAGCTACTTGTGTTGCAAAGAAGGAAGGAGCTATGAGATAATAGCTC
ACCACATCAGAGATCATGACGTTGATCTCGTTGAACACGCGCTTGACGCTGCCTTTGCCCAGACCGGCGTTCTCGCTCTGGGTAAATGATTTCTCGAGGT
TCAGGCCCAAGTTCACCCACATCCTGAAGATTCATGAAGTGCAAGACACAGAAAAGCGTCAGCCAAAAAGTCTGGGGTCATTGATGTAATCCACAGTCAG
TAAACTCACATGATGCCTCTGTTGCGGAGCGTGGCTCGGATCGACTCGAGCAGCTTGCTCAGGTCCACTTGCTCGGCGTTCTGCTGCTGGAGCGAGTTCC
ACTGGGTCAGCGACATGGGGTTCACGACAAAGCCACCGCCACCAGCGCTACCATTGCCACTTTGCCGCGACGCCATG