Description :
From Genome Similarity Track
Location :
Scaffold_566:6698- 9314
Sequence
2616 bases(100 bases per row)
TGGCTTTGGAGATGGAGCTCGATCAGTATCGGGACGATCTGGATGATATGGAAGCCGATCACGATCGGTTATCCTCCTTGCTTTCCGATCGGGACGACCA
AGTGGTTCGGCTCTAGACCCAGATCTCGGATCTGGAATCCGAGCGCGATCGCGATACACTTCAAGCAAGTATCAACACCTTCGCTACTAGCCTGGCTATA
CAGCCTTCGTCCAGTCCTGACCTTTTGACTCCATCCCTCCCTGGGCCATCAGGCGTGAAGGATGCGACGGCGCCCCCGAGTATCCGCAGCAGGCATCCTG
GAACTTCTTCTCCAGTTTTCCGCCTCCTGAACAAGAGGCCCAACACAGGTGCTTCCCACACTTCCCGTGCTTCCCCACAGTCACGCCGATACCCAAAACT
TCTGCTTCGTCTGTGCCCGATGGCCTCACCACGTTTTCTACTATAATTAAGACCCCCAAGAAAGGTGCTCCCCGTCTATCCCGCAATTCCAAGCGATCTC
CAGCAAAGTCAACGTCTAAGACGTCCGTTTCGTCCGGATCTGGTAGTCGCAAGAGCAAAGGCAAACCGCGATTCCACACTGCCGTGTCTAGCTCGGATGA
CGATGATGATACGTCGGATGCGGGGTCCCAAACGCCGGCTGCACTCTCCCGATCGCGCTCTTCTTCCCGGCGTAGGGTCCAGTCTGGTAGCTCGCTGCCT
TCGTACACCACTTCGCCAGATTTTAATCGTGGCGGACACCCCAGCCTCCCCGATCACTAACTCTCCCACGCCCAAAACCAAAACTTCCAGGCTGGAATTG
TTTGGTGATGCTTCTAGCAGTTCGGATAGCGCGATCAGTGTTGCGGAGGAATCTTGAGCCCCAGCCAATACGTTGTTGCCCCCGGCCGAATATGATGCTC
TTCCCAAGACTAAGGTGCACCGCGATCAGTGGATACCCGAATTTTGCCGTCGCACTCCAAAATATTCGATTCAAGTTTCACCTCAGTCCGCGCGCCGATT
GAGCTGGATCAGCGTGTCGGAATTGGAATTGGAGTTCTTCTGTCGTCATCTCGCAAGACCCTATCATTACCCCATCCCGGCTCTTCACGTTGTGTCGAAA
CCACTTTCAGTGTCGCAGTGGTCCGCTCGCCCGATTTCCTCGGCACAGATCGACACGCTTTACCGCCAGGAACTTTGGAAGTCTCTAAACACAAGATCGC
GCACGTGTCTTTCCAGCCCATTGATGGGGTAAGCAGTTGCTGGATATGTACCACTCCATCATGGATCTCTGTATCCAAACCTTGTGGGAATCGACCGACA
GTTTGCCAATCTCCTCCGCAGATCAGGTTCGCGATCCAGGGTTGGCTTCACATTGCGATCAGCGGAAGTAACGGCGATCGCGAACTGGCCCCCTCTGGAA
AACAGTTATCCGATAAATACCTTAGAGTGTGATTGAAGGCCATTGTGACATGGACATTCTGCTGGAGATATAAATATTTAAATCTGATATACAATAAGGG
ATTGTTCCGTTATTGTATATCAGATTTAAATAATTATATCTACATTACATGTCTCCTTAAGGTGTAGTCCTGTCAAGCGACATTCAGACCCCAGAGAAAA
AGAATGTGAAATGAAGGCACACAACATCATCAGATACCTCCCTTTTTATTGTACGGAGAAGGTGATAGGAAAAAGTAGGGTAATGATTGGTTTGGCAAGA
GTGATCTAATCAATTTAATCTGCGTATCTGCTATTTACACTACATTACCACAATTACACCCCTCATAATTTGATGCTGAAAAATAACACAATGACTTTTC
GAATTCCGACCAATCTACTTCAGTCCACCCAATAAAAAGAAATTGCAATATTTCAAACCCATCATTGGTAATTTTAGACATTGAAGAAGGATCAGTGCCG
TTGACTGCCTGGGAATAGCAGTCGCTGACGATCAGCGTACAGGTGCAACTGTGACTAGAGGACGAAGCGGTGCACTATAAGATCAAAATAACATTCAAAA
ATTGGCGAGCAATAACTAATACTCGACCACAATGATGACAACCTGTACGTTGTCAATTACAAGGTTTGCACTCTATTCTACGTCTATAGCATATCAATTG
CTTTCGTTGTATTGAATGGATCTTTACAGATGTATTGGTACAGCACATCTCATGCTAACTTTCAGGAGCGTCCTTATGTCAACATGAAAGGTATCCTAGT
AAGATAAAGACGAAACAGGTGATTTATATCGTAGCCACATCTGCCGCAAGACTCAGGTCCCACAAAATTAAGAAGTGATTTACTGTACAAGACAGTGTAA
ATCCATTAATAGCTGTGCTTGTCGAACAGTCCATCGTGTAGAAATACGCCTATTGAAACTTAAATCTTGACCTTTCGCACTTAATTTTCCTTAAAACAGC
CGTATACAAGATTAATGTATGCAGTCCATGCTTTTTCTTTCAAAAACGTAGTTCCCTAAATGATGGCAGTCGATGAAATGTCCGCATCATCGCTCCTGTT
TGTGTTCTTTGTGGTTTGTTTAGCCGCTGGAAAATGTATTTCACACATCTCAAGAGCAAGGCTTTACGCTAGAAGGCTGGTGTGTACCTGGATTTTAGAG
ATAACGACACGTTTTT