Description :
From Genome Similarity Track
Location :
Scaffold_423:6698- 8024
Sequence
1326 bases(100 bases per row)
CACGAGCACCACGAGCGCCGCGACCTTCTCGTACAGCGGCAGCTTAGTCCAGAGCACCTTGAGGTAGAAGACGAGCGGGAGCATGAGGCAGCAGACGGTG
ATGAACGTGGCGCCGGTGAAGTCGACGATGTCGAGGAAATGGTCGCGGAGTCCGATGGACACGCCGGCCTGGATGGCGATCAAGAGGATGCGCGCCGGCA
CGTAGCGCATCACATTTTTGGTGCCCTTATAGTCCGAGTCTTGGTCTTCGGTCGGCGAAGCCTCGGAGGTGACACTGTCGGTCGTCAGCTGAGCGCTGGC
GGCGGCCTCGGAAGATCCGGACGGGGTCGTGATCTGGCGGAAAGACGTCTTCTCCTGCAGCTCCAGGTCGTCGTCGATGATGACCACGTCAGCGGACTTG
TGCATGCCGAGGAAGAGTCGCTCGAGAGTGTAGAACGCCGGCTGGAGGATGGTTGAGAAGGCGATGGAGATGTGCAGCTGCATGAAGAGGAACGACATGA
GGACGGCACCGCGGTCGGCGGTGAAGCCGAGCGTCGTCGCCCCGAGCGGGTCCGACGTGTTGGCGATCGAGAAGAGGATGTTTCCGGAGATCTGGCATCC
ACCGGCACTGTATCCAACGACTGCGAGGATGAGGAAGAAGGCAGATGCCAAGCCAAGACTCGCGAGCACGACGCGCGGCATGCGCTTCGGGTCGGAGTGC
TGACGCTGCAGGTCGGGGATGATGATGGCGGCGCCGTAAGCCAGCGACAGGTTGCCAAAGCTGGTTACGACCTGGTGGAAGGTCACATCAGGTGCGGGGA
CGCTCGGGTGGCCGCGAAGGTTGTACAGCAGCACAGCGATGGCGATGACATCCGAGATGATGGTGCCGAGACAGCCGGCCACTGCGGCGCCGGTGCCTTC
CTTGAGCGTCGGGATGAGCGCGACCGGGATGACGAGCACGGCCATGAAGATGATCCAGACGGTCTGGTTGAACGAGTCAGGGAAGAGTACGTCCAGCAGC
ATCCCACCCAGAACCAAAAAGGCGCAGGGCGTCAGCAGACACACGCCGAGCTGCGAGATCATGACGAGGTAGTAACCCGTCTTTCCCATCGCCCAGCGAC
CGATGNNNNNNNNNNTGTAGGTCTTGACCGACGACGGCGCCACCAGCATCACTCGGGAGAGCGCGATCGTGGCGTACGTGTTGGCGAACGCCATGAAGAG
CAGCGCGATGGTTGCGAACACCGGCCCGGCGCGAGCGTAGTTGGACGGCATGGCGAGCGAACCGATGCCGCAGATGCAGCAGAAGATTTGGAAGCCGGCC
TTGGCATCCTCGAACGTGAAGAGCGC