Description :
From Genome Similarity Track
Location :
Scaffold_895:6696- 7853
Sequence
1157 bases(100 bases per row)
CACTTCTACCTGCCATTCGTAGGACATGTTTGCCGTACTGCTTTCGCACACTGCCTTAGCATGCAGCCActcactgtacgccaccagcgccgagACAATG
AAGGGAACATAGCCTCTAAAGAACACGGCAACAAGCTGAATAAGAGCGCGTCCGCCATCGATGGAGTGTGGCTCGTTCTGTGGTTCAAGGAGTTTGCTTC
TGACGTTGGTGAGGTGGTGCCCGTTCGGGTTCGTATGCAGAAAAACAAGGACAGTGTTGTCAACAAATACTATATTCGCGAAGCTTACAATCTTCTACTA
GCTACGTTCACTTAGGACGTTCTCCACGATGAGATGTACAAGTACGTTGCTAAAGGTATACACATGAGCCCGCCCGTACACCTTTAGAAATCTCATGTAC
CTCCACTGCTCCACCATCAAATTCCGGTCTGCGCAGTCAAACATGTGCGATCTGTGAACCGTTTACCACACAAGTATGCGCCACGGAGCTACCGCAGAGC
AAACCGATGAGCTGGGTCAACACATAGAGTCTGAACGTCGAATGAGGTAAGAAGCCGCAAGTTAATTTTGAAATATCGTTGGACACtaatatattttttt
ttactatgAACATTAAACGTGCGCACAAAATGGACAAAGGCGATGAACACGCGGAGGACGAAACAAACAAAGATGTGGCTGTGATCGTCATGGACGTCTC
GCAGCATTTAACAGTTCCGTCGGTCACATCGATGCCATCGCAGTGGTATTTTTGCTCGTTGCTTGCTGTGAGCGTCTTTGGCAAAACAATTACGAGAATG
GAGGGACACGGATCAACTATATCGACGTCGAGTTTGCAAGTGGACAAGGCAGCGACTAAATAAactcgatgctgcagcacttcatTCGTACTGTGCTGCT
TCCAACCGGAATGAAACGACTCATCGTCTACGCCGACAACTGCTCAGGCCAGAACAAGAACAACTATGTCATCAAGTTTTTACTGGCACAAGCCCACATG
GGAGTCTTCGAGCGAGTCAGCTATAAGTTCTTTGTGAAAGGCCACACAAAAACTCCTCTAGGCGTGGCTTTGGTCGCATTCGCAAGCGAGTAGCTCGTCA
AGACTGCTGGGTTTTGGATGATGGCGTCTCTGCTGTGGACGATTCGGCTACCGTCTT