Description :
From Genome Similarity Track
Location :
Scaffold_96:6695- 8686
Transcript NameFunction/comments
Physo_14123850S ribosomal protein L19
Physo_141239hypothetical protein

Sequence
1991 bases(100 bases per row)
CAAATAACCAGTCAGTCTACTGCAAAAACTTGCCAGGACCTCCCGCGCGCACACTCCACTCACGTTGCGGATGACGAAGGAGCTGCCCGTGCCGCGGTTT
CGCCGCGCCAGCACGACGCCCTTGACGCGCTGCACGCGGCTGCCGGTGCGGCTCAGCAGGTACTGCACCTCCACCGAGTCGCCGGGCTTGAAGTTGTCAA
TGTCCTTGCCCTCCGCGGCCTTGGCCACAGCCTCCGCCTCCAGCTGCTGCAGCAGCGACGCCGCGCGCTTGGTGGGGATCTTGAGCTTGGTGCGCTTGGG
CTGCTCGGCCGCGGGCGCGGGCGTGGCCGCCTCTGTGGAGAAGAGAGACACCTGCGCGCTCAGCAGAGGCGCGCGACGGGTCGAGGCGGCGCCCGCGGCG
CGCACGAAGCTCTTGGTGACGGCGGCCAGCATGGTCAGCGATGTGCCTCAGGAGCTCCCCGGGTTCTGCGGTCAATAGAGCTCGATGGCCATCCGGTGCA
CTGTGTGGTGCACACCATACCCTAAGCCTGAGTGATTACGTTTTGATTTACGCCTTGGCGATATATGCCTTTGTTTACAGTACCCTCGTGCCACTTACAG
CTAGTTTTCGCGTACAACATATATGGTATTAGTATCTAGTATACTTCCCATGATAACTAGCGATCTATCGTTAGTTGTAGGAGGATTGAATAACTTCACT
CATTGATATTGTCGGCAGCACTCGCCCATAGGCTGACAAAGTCCATCTCGGTGACGCGGACAGGTTTGTAGAGCTAGCGGCTAGAGGGAACTGTCCTCAA
CCTCTACACGTCTCGCTCCAGGTCGTCGCTGGTGTCGCTGTCGCTGCTGATGAGCGCACGCTTGAGTTCGTCAACCGCCGGGCCCTTCTCGTCCGGGTAG
ACGGGCTTCCGCTTGTTCCACGAGTCCATGAGCTCCTCCAGGAACCGGTACACGAAGAGCCCCGACATGATGAACAACAAACCCGCGATATCCTTCGCGT
GCAGTGGCTGGTGCTGCGGCATGAATGGGAACGTGAAAGCGACGTTGCCGAGCGGAACCATAATTGTCATGGCCTGGAACAAAACACAACACAAAACACA
ACGGTTAAAAAAATACCTGAAACAATCCCCTTCAGCGTCACTTGCCAGCCAGAGGATGTTAGCGCTGCCGAACTTGAGAATCAGGATAATCAGCAGGTTG
TATGCCACATTGAACAGCAGATACGCCGTCACGTAAATGGTGGCCTTCTCGCAGTCGTCTTTGTGTCCACCCTCAGTGATGGTGTTCTGCCCCAGGTAGC
ACATCAAGCCGTCGTACAGATTTTCTGGGAGTTCTCTGGGTGTAACTGGGTGATCGCCAACCATTGCCGCGGGAAACGTCAGCGGGATTGCAAACAGGAA
CTGGAAGACAGCGATCCAGCCGTTCAGGTAGACTGCATCTAGCTCCGCCTCGCCCAGCGTCTTCTCCTTGAACACGCTGGACAGGCAAATAGGGACGCAG
CTGACTATCATAACAACAGACCACAGCACGACGAGGTGCGGATTGGTGCCACTGCTGCTGCTAGAGGCACCAGACCCGAGCACGATGAGCAGACCCAGTG
AAACGACCACTGCGCCAACATACTGGTAGCCAGAGTACTTGGCCTTGAGCAGCAGACTGGAGATCAGCATCGAAATGGGGATCGCAGCCTGGCCCAGCAA
GATGATAAGGGATCCTCCCAGGTACGTGGCTGCAAACACCTGCAGGATTCCGGCAATGGAGTCGAGTCCTCCCATGACCGCGAACTTGCGCTTTGGAATG
CTACGCTGGTCCCACGTGATGGCACTTCCGTACTTGATCATCGGCAGGATGTACGCGAAGCTGATAGGAATCTGCAGGCAGTTGCATCAAGAGATCAGTA
AAAGCCATTGCACGCACTCGAAAGACCCAACGCCAAGGGGCGCACGCAGTACGCACGTAGACGAACGTGGTGAGCAGGTTCAGGAACGTCG